Starting /dee2/code/volunteer_pipeline.sh SRR3207742 current disk space = 3057299116032 free memory = 1430104768 SRR3207742 SRAfilesize 899cd603c196dfb05351d7737b399914 SRR3207742.sra SRR3207742.sra file validated SRR3207742 is single end SRR3207742 is conventional basespace SRR3207742 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207742_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.01025 39.0 36.0 40.0 33.0 40.0 2 36.65 39.0 36.0 40.0 31.0 40.0 3 36.58825 38.0 36.0 40.0 31.0 40.0 4 36.62825 38.0 36.0 40.0 31.0 40.0 5 36.691 39.0 36.0 40.0 31.0 40.0 6 36.69425 38.0 36.0 40.0 31.0 40.0 7 36.74525 38.0 36.0 40.0 31.0 40.0 8 36.526 38.0 35.0 40.0 31.0 40.0 9 36.56325 38.0 35.0 39.0 31.0 40.0 10 36.58175 38.0 35.0 39.0 31.0 40.0 11 36.62175 38.0 35.0 40.0 31.0 40.0 12 36.493 38.0 35.0 39.0 31.0 40.0 13 36.479 38.0 35.0 39.0 31.0 40.0 14 36.503 38.0 35.0 39.0 31.0 40.0 15 36.48525 38.0 35.0 39.0 31.0 40.0 16 36.55175 38.0 35.0 39.0 31.0 40.0 17 36.31625 38.0 35.0 39.0 31.0 40.0 18 36.32025 38.0 35.0 39.0 31.0 40.0 19 36.102 38.0 35.0 39.0 30.0 40.0 20 36.042 38.0 35.0 39.0 30.0 40.0 21 35.9415 38.0 35.0 39.0 30.0 40.0 22 35.989 38.0 35.0 39.0 30.0 40.0 23 35.78425 38.0 35.0 39.0 29.0 40.0 24 35.85825 38.0 35.0 39.0 29.0 40.0 25 35.71775 38.0 35.0 39.0 29.0 40.0 26 35.4275 38.0 35.0 39.0 29.0 40.0 27 35.33475 38.0 34.0 39.0 28.0 40.0 28 35.21325 38.0 33.0 39.0 28.0 40.0 29 34.9945 38.0 33.0 39.0 27.0 40.0 30 35.05825 38.0 33.0 39.0 28.0 40.0 31 35.01925 38.0 34.0 39.0 28.0 40.0 32 34.96675 38.0 33.0 39.0 28.0 40.0 33 34.96175 38.0 34.0 39.0 27.0 40.0 34 34.82425 38.0 33.0 39.0 27.0 40.0 35 34.917 38.0 33.0 39.0 28.0 40.0 36 35.12925 38.0 35.0 39.0 28.0 40.0 37 34.8335 38.0 33.0 39.0 27.0 40.0 38 34.7055 38.0 33.0 39.0 27.0 40.0 39 34.644 38.0 33.0 39.0 27.0 40.0 40 34.48625 38.0 33.0 39.0 27.0 40.0 41 34.5375 38.0 33.0 39.0 27.0 40.0 42 34.3125 37.0 33.0 39.0 27.0 40.0 43 34.1125 37.0 33.0 39.0 27.0 40.0 44 33.974 37.0 33.0 39.0 26.0 40.0 45 33.874 37.0 33.0 39.0 26.0 40.0 46 34.00825 37.0 33.0 39.0 26.0 40.0 47 33.6195 36.0 33.0 39.0 26.0 40.0 48 33.48875 36.0 33.0 39.0 24.0 40.0 49 33.28175 36.0 32.0 39.0 24.0 40.0 50 33.21425 36.0 33.0 39.0 23.0 40.0 51 32.94 36.0 32.0 39.0 23.0 40.0 52 32.35425 36.0 31.0 39.0 20.0 39.0 53 32.2 36.0 31.0 38.0 20.0 39.0 54 32.04975 35.0 31.0 38.0 18.0 39.0 55 32.037 36.0 31.0 38.0 18.0 39.0 56 31.542 35.0 31.0 38.0 13.0 39.0 57 31.18775 35.0 30.0 38.0 12.0 39.0 58 30.85525 35.0 30.0 38.0 10.0 39.0 59 30.8745 35.0 30.0 38.0 2.0 39.0 60 30.42375 35.0 29.0 38.0 2.0 39.0 61 30.15175 35.0 29.0 38.0 2.0 39.0 62 30.13175 35.0 29.0 38.0 2.0 39.0 63 29.9855 35.0 29.0 38.0 2.0 39.0 64 29.35725 34.0 29.0 37.0 2.0 39.0 65 29.099 33.0 28.0 37.0 2.0 39.0 66 28.636 33.0 28.0 36.0 2.0 39.0 67 28.28825 33.0 27.0 36.0 2.0 39.0 68 27.6735 33.0 26.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 0.0 4 0.0 5 0.0 6 1.0 7 3.0 8 2.0 9 3.0 10 9.0 11 9.0 12 8.0 13 17.0 14 7.0 15 14.0 16 20.0 17 12.0 18 11.0 19 20.0 20 26.0 21 30.0 22 30.0 23 46.0 24 48.0 25 46.0 26 49.0 27 70.0 28 88.0 29 85.0 30 113.0 31 131.0 32 160.0 33 207.0 34 260.0 35 358.0 36 479.0 37 632.0 38 591.0 39 399.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.77059120768065 14.780192016169783 17.938352703385547 41.51086407276402 2 17.65 26.6 36.275 19.475 3 22.575 29.725 25.224999999999998 22.475 4 24.45 34.2 19.575 21.775 5 24.224999999999998 35.85 22.650000000000002 17.275 6 18.2 38.175 24.3 19.325 7 17.25 16.650000000000002 43.75 22.35 8 19.725 22.325 28.925 29.025000000000002 9 19.875 22.675 31.724999999999998 25.724999999999998 10 21.224999999999998 38.975 23.625 16.175 11 25.75 27.55 20.825 25.874999999999996 12 21.275 24.85 29.075 24.8 13 20.225 28.7 30.75 20.325 14 19.375 27.975 30.625000000000004 22.025 15 22.3 28.725 26.424999999999997 22.55 16 21.099999999999998 28.625 28.025 22.25 17 21.475 28.725 27.3 22.5 18 20.375 29.225 28.275 22.125 19 21.175 29.049999999999997 27.075 22.7 20 22.15 28.65 26.125 23.075000000000003 21 21.5 28.449999999999996 27.325 22.725 22 22.95 27.200000000000003 26.875 22.975 23 21.025 29.5 27.500000000000004 21.975 24 21.775 29.65 27.700000000000003 20.875 25 22.1 30.049999999999997 26.974999999999998 20.875 26 21.0 29.7 27.750000000000004 21.55 27 21.224999999999998 29.049999999999997 27.450000000000003 22.275 28 22.875 27.0 28.425 21.7 29 22.8 29.225 27.625 20.349999999999998 30 22.975 28.275 28.125 20.625 31 22.400000000000002 28.575 27.075 21.95 32 21.05 29.45 28.15 21.349999999999998 33 22.025 27.900000000000002 28.275 21.8 34 22.325 29.075 26.724999999999998 21.875 35 22.475 27.925 28.275 21.325 36 21.775 28.4 27.525 22.3 37 21.425 28.875 28.15 21.55 38 21.975 28.075 28.15 21.8 39 22.125 28.875 26.6 22.400000000000002 40 22.25 28.775000000000002 27.725 21.25 41 23.05 28.975 27.150000000000002 20.825 42 22.225 29.025000000000002 27.55 21.2 43 22.275 29.65 27.325 20.75 44 22.175 27.875 28.15 21.8 45 21.6 28.249999999999996 27.3 22.85 46 21.875 27.450000000000003 28.725 21.95 47 22.575 27.400000000000002 29.099999999999998 20.925 48 20.9 29.7 27.125 22.275 49 21.85 29.725 27.975 20.45 50 22.0 27.675 26.875 23.45 51 21.85 29.175 27.325 21.65 52 22.400000000000002 27.500000000000004 28.075 22.025 53 23.200000000000003 28.725 27.474999999999998 20.599999999999998 54 20.275000000000002 30.125 27.1 22.5 55 21.875 28.65 28.375 21.099999999999998 56 23.275000000000002 28.225 27.525 20.974999999999998 57 22.025 27.750000000000004 28.825 21.4 58 21.475 29.599999999999998 27.025 21.9 59 22.525000000000002 28.575 28.15 20.75 60 21.85 28.375 26.875 22.900000000000002 61 21.6 29.175 27.1 22.125 62 21.775 30.0 27.224999999999998 21.0 63 21.7 28.325 29.375 20.599999999999998 64 21.75 27.85 29.525000000000002 20.875 65 22.175 27.1 27.975 22.75 66 22.35 27.200000000000003 26.8 23.65 67 20.025000000000002 29.875 28.075 22.025 68 22.575 28.325 27.700000000000003 21.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.5 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 4.0 22 5.0 23 7.0 24 10.0 25 11.0 26 15.5 27 27.0 28 34.0 29 36.5 30 46.5 31 54.0 32 66.0 33 96.5 34 115.0 35 128.5 36 159.5 37 177.0 38 205.5 39 260.0 40 295.0 41 304.0 42 330.5 43 358.0 44 359.0 45 350.0 46 325.5 47 310.0 48 293.0 49 244.5 50 213.0 51 198.0 52 150.5 53 118.0 54 109.5 55 85.5 56 70.0 57 49.5 58 36.0 59 43.0 60 36.0 61 22.0 62 15.0 63 14.0 64 9.5 65 5.0 66 4.0 67 3.0 68 3.0 69 4.0 70 3.5 71 2.0 72 1.0 73 0.5 74 2.5 75 5.0 76 2.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267331 spots for SRR3207742.sra Written 267331 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra Read 267326 spots for SRR3207742.sra Written 267326 spots for SRR3207742.sra SRR ids: ['SRR3207742.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dg5natm4 SRR3207742.sra spots: 5346525 blocks: [[1, 267326], [267327, 534652], [534653, 801978], [801979, 1069304], [1069305, 1336630], [1336631, 1603956], [1603957, 1871282], [1871283, 2138608], [2138609, 2405934], [2405935, 2673260], [2673261, 2940586], [2940587, 3207912], [3207913, 3475238], [3475239, 3742564], [3742565, 4009890], [4009891, 4277216], [4277217, 4544542], [4544543, 4811868], [4811869, 5079194], [5079195, 5346525]] SRR3207742 file size 1122433 SRR3207742 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207742 SRR3207742_1.fastq Input file: SRR3207742_1.fastq trimmed: SRR3207742-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 18:51:43 2025 >> started Mon Feb 10 18:51:46 2025 >> done (2.727s) 5346525 reads processed; of these: 8540 ( 0.16%) short reads filtered out after trimming by size control 6576 ( 0.12%) empty reads filtered out after trimming by size control 5331409 (99.72%) reads available; of these: 711159 (13.34%) trimmed reads available after processing 4620250 (86.66%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1376 0.03% 19 2341 0.04% 20 4003 0.08% 21 1420 0.03% 22 1925 0.04% 23 3111 0.06% 24 5249 0.10% 25 8795 0.16% 26 2345 0.04% 27 2935 0.06% 28 4083 0.08% 29 6100 0.11% 30 9479 0.18% 31 2654 0.05% 32 3563 0.07% 33 4122 0.08% 34 6068 0.11% 35 9877 0.19% 36 3120 0.06% 37 4012 0.08% 38 5843 0.11% 39 9464 0.18% 40 15427 0.29% 41 4064 0.08% 42 5488 0.10% 43 7854 0.15% 44 13144 0.25% 45 21391 0.40% 46 5574 0.10% 47 7579 0.14% 48 11120 0.21% 49 17785 0.33% 50 29792 0.56% 51 7572 0.14% 52 9697 0.18% 53 14651 0.27% 54 24446 0.46% 55 40591 0.76% 56 9920 0.19% 57 13612 0.26% 58 20200 0.38% 59 34349 0.64% 60 59260 1.11% 61 13533 0.25% 62 18223 0.34% 63 27046 0.51% 64 44785 0.84% 65 73464 1.38% 66 18766 0.35% 67 39941 0.75% 68 4620250 86.66% 5331409 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=29.43 fanout-score-rank=9 prefix-density=0.13 prefix-fanout=9.3 sequence=CACCAGCACCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=16 fanout-score=158.95 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=19.4 sequence=TTCTTCTTCTTT Started job on | Feb 10 18:52:02 Started mapping on | Feb 10 18:52:02 Finished on | Feb 10 18:52:08 Mapping speed, Million of reads per hour | 3198.85 Number of input reads | 5331409 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 5050185 Uniquely mapped reads % | 94.73% Average mapped length | 66.09 Number of splices: Total | 928077 Number of splices: Annotated (sjdb) | 913243 Number of splices: GT/AG | 914737 Number of splices: GC/AG | 11064 Number of splices: AT/AC | 992 Number of splices: Non-canonical | 1284 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 177107 % of reads mapped to multiple loci | 3.32% Number of reads mapped to too many loci | 78718 % of reads mapped to too many loci | 1.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 104117 104117 104117 N_multimapping 177107 177107 177107 N_noFeature 231026 2618728 2625522 N_ambiguous 52367 7645 7817 UnstrandedReadsAssigned:4766792 PositiveStrandReadsAssigned:2423812 NegativeStrandReadsAssigned:2416846 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207742 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207742-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,331,409 reads, 4,912,782 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 957 rounds 52401 SRR3207742.ke.tsv 34699 SRR3207742.se.tsv 87100 total ==> SRR3207742.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 126 19.7228 Potri.005G024800.1.v4.1 1035 936 11 3.53012 Potri.004G059700.1.v4.1 961 862 3 1.04541 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 92.5803 9.77826 Potri.016G087400.1.v4.1 270 171 180 316.191 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 20 3.58878 Potri.012G127500.1.v4.1 977 878 570 195.008 ==> SRR3207742.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 577 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 100 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207742 completed mapping pipeline successfully