Starting /dee2/code/volunteer_pipeline.sh SRR3207743 current disk space = 3056870588416 free memory = 1565300220 SRR3207743 SRAfilesize b05842c8736420ad3eabb78a087896cc SRR3207743.sra SRR3207743.sra file validated SRR3207743 is single end SRR3207743 is conventional basespace SRR3207743 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207743_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.13 34.0 31.0 34.0 30.0 34.0 2 32.203 34.0 33.0 34.0 30.0 34.0 3 32.9575 34.0 33.0 34.0 30.0 34.0 4 36.48675 37.0 37.0 37.0 35.0 37.0 5 36.43625 37.0 37.0 37.0 35.0 37.0 6 36.1725 37.0 37.0 37.0 35.0 37.0 7 36.37975 37.0 37.0 37.0 35.0 37.0 8 36.327 37.0 37.0 37.0 35.0 37.0 9 38.33625 39.0 39.0 39.0 37.0 39.0 10-11 38.349875 39.0 39.0 39.0 37.0 39.0 12-13 38.239374999999995 39.0 39.0 39.0 37.0 39.0 14-15 39.879625000000004 41.0 40.0 41.0 38.0 41.0 16-17 39.9305 41.0 40.0 41.0 38.0 41.0 18-19 39.839875 41.0 40.0 41.0 38.0 41.0 20-21 39.673625 41.0 40.0 41.0 37.0 41.0 22-23 39.499624999999995 41.0 40.0 41.0 36.5 41.0 24-25 39.254875 41.0 39.0 41.0 36.0 41.0 26-27 38.424125000000004 40.0 38.0 41.0 33.5 41.0 28-29 38.494125 40.0 38.0 41.0 34.5 41.0 30-31 38.470375 40.0 38.0 41.0 34.0 41.0 32-33 38.374624999999995 40.0 38.0 41.0 34.0 41.0 34-35 38.37625 40.0 38.0 41.0 34.0 41.0 36-37 38.206625 40.0 38.0 41.0 33.5 41.0 38-39 38.763374999999996 41.0 39.0 41.0 35.0 41.0 40-41 38.716375 41.0 39.0 41.0 35.0 41.0 42-43 38.659625000000005 41.0 39.0 41.0 35.0 41.0 44-45 38.494 41.0 38.5 41.0 34.5 41.0 46-47 37.98775 40.5 38.5 41.0 33.0 41.0 48-49 38.019999999999996 40.0 38.0 41.0 33.0 41.0 50-51 37.889875 40.0 38.0 41.0 32.5 41.0 52-53 37.807625 40.0 38.0 41.0 33.0 41.0 54-55 37.64775 40.0 38.0 41.0 33.0 41.0 56-57 37.3665 40.0 37.5 41.0 32.5 41.0 58-59 36.539125 39.5 36.0 41.0 29.5 41.0 60-61 36.357 39.0 36.0 41.0 29.5 41.0 62-63 36.141125 39.0 35.0 41.0 29.0 41.0 64-65 35.785125 39.0 35.0 41.0 28.5 41.0 66-67 35.542375 38.0 35.0 40.0 29.0 41.0 68-69 34.422625 37.0 34.0 39.5 26.0 41.0 70-71 34.204875 36.5 34.0 39.0 26.0 41.0 72-73 33.84075 36.0 34.0 39.0 26.0 40.5 74-75 33.4935 36.0 34.0 38.5 26.0 39.5 76-77 32.280874999999995 35.0 32.0 37.0 25.0 39.0 78-79 32.638374999999996 35.0 33.0 37.0 26.0 39.0 80-81 32.247375 35.0 33.0 36.5 25.0 38.0 82-83 31.954875 35.0 33.0 36.0 24.5 37.0 84-85 31.604750000000003 35.0 33.0 36.0 23.5 37.0 86-87 31.013875 35.0 32.5 35.0 19.0 36.0 88-89 30.13125 35.0 31.0 35.0 7.0 36.0 90-91 29.724375000000002 34.5 30.5 35.0 2.0 36.0 92-93 28.846125 34.0 29.0 35.0 2.0 35.0 94-95 28.509875 34.0 29.0 35.0 2.0 35.0 96-97 28.542749999999998 34.0 29.5 35.0 2.0 35.0 98-99 28.5505 34.0 30.0 35.0 2.0 35.0 100 28.29425 34.0 30.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 4.0 10 8.0 11 10.0 12 9.0 13 9.0 14 9.0 15 10.0 16 9.0 17 17.0 18 20.0 19 18.0 20 20.0 21 16.0 22 16.0 23 27.0 24 25.0 25 33.0 26 42.0 27 35.0 28 61.0 29 44.0 30 68.0 31 76.0 32 74.0 33 111.0 34 156.0 35 227.0 36 373.0 37 816.0 38 1361.0 39 294.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.937533368926854 14.869193806727177 15.696743192738921 40.496529631607046 2 20.075000000000003 23.1 37.525 19.3 3 23.325000000000003 27.625 26.724999999999998 22.325 4 25.05 32.9 20.175 21.875 5 24.55 35.25 22.55 17.65 6 18.275 38.35 23.474999999999998 19.900000000000002 7 16.325 18.75 43.824999999999996 21.099999999999998 8 18.8 24.099999999999998 29.799999999999997 27.3 9 21.0 23.474999999999998 31.2 24.325 10-11 23.1375 33.775 21.6 21.4875 12-13 20.3375 26.7125 29.599999999999998 23.35 14-15 21.0 28.225 28.5625 22.2125 16-17 21.55 28.275 27.5625 22.6125 18-19 21.3 29.062500000000004 26.787499999999998 22.85 20-21 21.7875 29.0875 27.425 21.7 22-23 21.0125 28.3375 27.975 22.675 24-25 21.7375 28.237499999999997 27.787499999999998 22.237499999999997 26-27 21.9625 28.712500000000002 27.5875 21.7375 28-29 22.475 27.537499999999998 28.000000000000004 21.987499999999997 30-31 21.587500000000002 28.0875 27.900000000000002 22.425 32-33 21.45 28.525 27.800000000000004 22.225 34-35 22.275 27.5625 28.012500000000003 22.15 36-37 21.7 28.849999999999998 27.0 22.45 38-39 22.275 28.6375 27.375 21.712500000000002 40-41 22.237499999999997 27.650000000000002 28.775000000000002 21.337500000000002 42-43 22.525000000000002 28.1 27.05 22.325 44-45 22.2625 28.487499999999997 26.7125 22.537499999999998 46-47 22.0125 27.8875 27.9375 22.162499999999998 48-49 21.825 27.575 28.375 22.225 50-51 22.175 28.125 27.5125 22.1875 52-53 21.2625 27.950000000000003 28.8375 21.95 54-55 22.275 28.725 27.425 21.575 56-57 22.30278784848106 27.91598949868734 27.25340667583448 22.527815976997125 58-59 21.65 29.062500000000004 27.700000000000003 21.587500000000002 60-61 21.85 27.250000000000004 28.462500000000002 22.4375 62-63 22.2625 28.1125 27.425 22.2 64-65 22.375 27.3625 28.1375 22.125 66-67 22.175 28.212500000000002 28.000000000000004 21.6125 68-69 22.625 28.487499999999997 28.0875 20.8 70-71 21.65 28.012500000000003 27.6375 22.7 72-73 21.825 29.1875 26.875 22.112499999999997 74-75 21.65 28.125 28.3125 21.912499999999998 76-77 22.787499999999998 28.712500000000002 26.825 21.675 78-79 22.1375 28.425 27.537499999999998 21.9 80-81 22.037499999999998 28.175 28.3375 21.45 82-83 22.3125 28.199999999999996 27.487499999999997 22.0 84-85 21.775 27.950000000000003 27.224999999999998 23.05 86-87 22.6375 28.1125 26.650000000000002 22.6 88-89 22.2625 27.462500000000002 27.6 22.675 90-91 21.349999999999998 29.075 27.762500000000003 21.8125 92-93 21.475 28.4125 27.825 22.287499999999998 94-95 22.1875 28.225 27.8125 21.775 96-97 22.3875 28.0875 27.474999999999998 22.05 98-99 21.825 28.287499999999998 28.3375 21.55 100 22.125 27.950000000000003 27.625 22.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 1.5 22 0.5 23 2.0 24 3.0 25 3.0 26 5.0 27 6.5 28 7.5 29 15.0 30 23.5 31 27.0 32 36.0 33 53.0 34 65.5 35 79.0 36 95.5 37 125.0 38 158.5 39 173.0 40 174.5 41 204.0 42 235.5 43 252.0 44 269.0 45 262.5 46 240.0 47 237.5 48 224.0 49 182.0 50 156.0 51 130.0 52 107.5 53 93.0 54 72.5 55 52.5 56 40.5 57 35.5 58 27.5 59 19.5 60 20.0 61 15.0 62 11.0 63 8.5 64 4.5 65 4.0 66 3.5 67 4.5 68 4.5 69 2.5 70 4.5 71 4.0 72 2.5 73 2.5 74 1.0 75 0.5 76 0.5 77 1.5 78 1.0 79 1.0 80 1.0 81 1.0 82 1.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0125 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.037500000000000006 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.0625 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603476 spots for SRR3207743.sra Written 1603476 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra Read 1603471 spots for SRR3207743.sra Written 1603471 spots for SRR3207743.sra SRR ids: ['SRR3207743.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hz2ribjg SRR3207743.sra spots: 32069425 blocks: [[1, 1603471], [1603472, 3206942], [3206943, 4810413], [4810414, 6413884], [6413885, 8017355], [8017356, 9620826], [9620827, 11224297], [11224298, 12827768], [12827769, 14431239], [14431240, 16034710], [16034711, 17638181], [17638182, 19241652], [19241653, 20845123], [20845124, 22448594], [22448595, 24052065], [24052066, 25655536], [25655537, 27259007], [27259008, 28862478], [28862479, 30465949], [30465950, 32069425]] SRR3207743 file size 8335001 SRR3207743 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207743 SRR3207743_1.fastq Input file: SRR3207743_1.fastq trimmed: SRR3207743-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 19:23:53 2025 >> started Mon Feb 10 19:24:10 2025 >> done (16.374s) 32069425 reads processed; of these: 5942 ( 0.02%) short reads filtered out after trimming by size control 9925 ( 0.03%) empty reads filtered out after trimming by size control 32053558 (99.95%) reads available; of these: 3051959 ( 9.52%) trimmed reads available after processing 29001599 (90.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1618 0.01% 19 2510 0.01% 20 3522 0.01% 21 4784 0.01% 22 6761 0.02% 23 9879 0.03% 24 13952 0.04% 25 18318 0.06% 26 17493 0.05% 27 17446 0.05% 28 17450 0.05% 29 18052 0.06% 30 19457 0.06% 31 19476 0.06% 32 19555 0.06% 33 19011 0.06% 34 20179 0.06% 35 20182 0.06% 36 21781 0.07% 37 21245 0.07% 38 21928 0.07% 39 22396 0.07% 40 22930 0.07% 41 23477 0.07% 42 24902 0.08% 43 25200 0.08% 44 25659 0.08% 45 25947 0.08% 46 26643 0.08% 47 26261 0.08% 48 26722 0.08% 49 27130 0.08% 50 27508 0.09% 51 27611 0.09% 52 27444 0.09% 53 27933 0.09% 54 28310 0.09% 55 27508 0.09% 56 28218 0.09% 57 28285 0.09% 58 28033 0.09% 59 28779 0.09% 60 27859 0.09% 61 28470 0.09% 62 28625 0.09% 63 28618 0.09% 64 29262 0.09% 65 29820 0.09% 66 30759 0.10% 67 31370 0.10% 68 31842 0.10% 69 31186 0.10% 70 33304 0.10% 71 32774 0.10% 72 33347 0.10% 73 33864 0.11% 74 33883 0.11% 75 35506 0.11% 76 24131 0.08% 77 27607 0.09% 78 31341 0.10% 79 33057 0.10% 80 34478 0.11% 81 36297 0.11% 82 37793 0.12% 83 39548 0.12% 84 41171 0.13% 85 43175 0.13% 86 44165 0.14% 87 46976 0.15% 88 49942 0.16% 89 53579 0.17% 90 58905 0.18% 91 65119 0.20% 92 73267 0.23% 93 82345 0.26% 94 97558 0.30% 95 116230 0.36% 96 130664 0.41% 97 164937 0.51% 98 176779 0.55% 99 170911 0.53% 100 29001599 90.48% 32053558 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=45.81 fanout-score-rank=4 prefix-density=0.36 prefix-fanout=33.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=6 fanout-score=165.76 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=22.4 sequence=AAGAAGAAGAAA Started job on | Feb 10 19:24:29 Started mapping on | Feb 10 19:24:30 Finished on | Feb 10 19:25:02 Mapping speed, Million of reads per hour | 3606.03 Number of input reads | 32053558 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 29769149 Uniquely mapped reads % | 92.87% Average mapped length | 97.47 Number of splices: Total | 8471863 Number of splices: Annotated (sjdb) | 8322235 Number of splices: GT/AG | 8346838 Number of splices: GC/AG | 103039 Number of splices: AT/AC | 7843 Number of splices: Non-canonical | 14143 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 719455 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 1169227 % of reads mapped to too many loci | 3.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.21% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1564954 1564954 1564954 N_multimapping 719455 719455 719455 N_noFeature 1365666 15433508 15499352 N_ambiguous 300282 48961 49808 UnstrandedReadsAssigned:28103201 PositiveStrandReadsAssigned:14286680 NegativeStrandReadsAssigned:14219989 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207743 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207743-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,053,558 reads, 29,466,603 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR3207743.ke.tsv 34699 SRR3207743.se.tsv 87100 total ==> SRR3207743.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 701 18.3591 Potri.005G024800.1.v4.1 1035 936 102.009 5.47737 Potri.004G059700.1.v4.1 961 862 22 1.2827 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 501.284 8.85854 Potri.016G087400.1.v4.1 270 171 1218.55 358.142 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 95 2.85218 Potri.012G127500.1.v4.1 977 878 3820 218.664 ==> SRR3207743.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3206 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 515 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 74 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207743 completed mapping pipeline successfully