Starting /dee2/code/volunteer_pipeline.sh SRR3207744 current disk space = 3057454374912 free memory = 1478087152 SRR3207744 SRAfilesize 21f36a829e22359dde4ffbdccb1201c6 SRR3207744.sra SRR3207744.sra file validated SRR3207744 is single end SRR3207744 is conventional basespace SRR3207744 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207744_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.23475 39.0 37.0 40.0 33.0 40.0 2 36.80275 39.0 36.0 40.0 32.0 40.0 3 36.71425 38.0 36.0 40.0 31.0 40.0 4 36.7575 39.0 36.0 40.0 31.0 40.0 5 36.7445 39.0 36.0 40.0 32.0 40.0 6 36.817 39.0 36.0 40.0 32.0 40.0 7 36.77275 39.0 36.0 40.0 31.0 40.0 8 36.6965 38.0 36.0 40.0 31.0 40.0 9 36.6355 38.0 36.0 40.0 31.0 40.0 10 36.58375 38.0 35.0 40.0 31.0 40.0 11 36.73625 38.0 36.0 40.0 32.0 40.0 12 36.56925 38.0 35.0 39.0 31.0 40.0 13 36.469 38.0 35.0 39.0 31.0 40.0 14 36.5105 38.0 35.0 39.0 31.0 40.0 15 36.39175 38.0 35.0 39.0 31.0 40.0 16 36.43175 38.0 35.0 39.0 31.0 40.0 17 36.348 38.0 35.0 39.0 31.0 40.0 18 36.17925 38.0 35.0 39.0 30.0 40.0 19 36.27375 38.0 35.0 39.0 31.0 40.0 20 36.18925 38.0 35.0 39.0 31.0 40.0 21 36.257 38.0 35.0 39.0 31.0 40.0 22 35.9545 38.0 35.0 39.0 30.0 40.0 23 35.82425 38.0 35.0 39.0 29.0 40.0 24 35.73475 38.0 35.0 39.0 29.0 40.0 25 35.621 38.0 35.0 39.0 29.0 40.0 26 35.32475 38.0 35.0 39.0 28.0 40.0 27 34.92425 38.0 33.0 39.0 27.0 40.0 28 34.9165 38.0 33.0 39.0 27.0 40.0 29 34.77 38.0 33.0 39.0 27.0 40.0 30 34.67325 38.0 33.0 39.0 27.0 40.0 31 34.9885 38.0 34.0 39.0 28.0 40.0 32 34.88825 38.0 33.0 39.0 27.0 40.0 33 34.85725 38.0 33.0 39.0 27.0 40.0 34 34.7395 38.0 33.0 39.0 27.0 40.0 35 34.7885 38.0 33.0 39.0 27.0 40.0 36 35.08225 38.0 34.0 39.0 29.0 40.0 37 34.793 38.0 34.0 39.0 27.0 40.0 38 34.74 38.0 33.0 39.0 27.0 40.0 39 34.58675 38.0 33.0 39.0 27.0 40.0 40 34.49125 37.0 33.0 39.0 27.0 40.0 41 34.35425 38.0 33.0 39.0 27.0 40.0 42 33.956 37.0 33.0 39.0 26.0 40.0 43 33.933 37.0 33.0 39.0 26.0 40.0 44 33.72025 36.0 33.0 39.0 25.0 40.0 45 33.46975 36.0 33.0 39.0 25.0 40.0 46 33.5085 36.0 33.0 39.0 24.0 40.0 47 33.25325 36.0 33.0 39.0 23.0 40.0 48 32.928 36.0 32.0 39.0 23.0 40.0 49 32.948 36.0 32.0 39.0 23.0 40.0 50 32.53325 36.0 31.0 39.0 22.0 40.0 51 32.31375 36.0 31.0 39.0 20.0 40.0 52 32.06425 36.0 31.0 38.0 19.0 39.0 53 31.9045 35.0 31.0 38.0 18.0 39.0 54 31.7695 35.0 31.0 38.0 17.0 39.0 55 31.5375 35.0 31.0 38.0 16.0 39.0 56 31.2065 35.0 31.0 38.0 5.0 39.0 57 30.75175 35.0 30.0 38.0 2.0 39.0 58 30.61475 35.0 30.0 38.0 2.0 39.0 59 30.33175 35.0 29.0 38.0 2.0 39.0 60 29.613 34.0 29.0 37.0 2.0 39.0 61 29.50725 34.0 29.0 37.0 2.0 39.0 62 29.37525 34.0 29.0 37.0 2.0 39.0 63 29.08625 33.0 28.0 37.0 2.0 39.0 64 28.84125 33.0 28.0 37.0 2.0 39.0 65 28.48875 33.0 27.0 36.0 2.0 39.0 66 27.8925 33.0 26.0 36.0 2.0 39.0 67 27.6 33.0 26.0 36.0 2.0 39.0 68 27.01075 33.0 23.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 2.0 4 1.0 5 1.0 6 4.0 7 2.0 8 5.0 9 0.0 10 9.0 11 10.0 12 17.0 13 16.0 14 11.0 15 17.0 16 17.0 17 20.0 18 19.0 19 18.0 20 18.0 21 30.0 22 37.0 23 43.0 24 51.0 25 36.0 26 60.0 27 60.0 28 73.0 29 93.0 30 113.0 31 141.0 32 168.0 33 233.0 34 274.0 35 361.0 36 452.0 37 607.0 38 638.0 39 328.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.819146249052793 15.483708007072494 18.716847688810308 41.98029805506441 2 18.675 26.025 33.825 21.475 3 23.575 29.675 24.55 22.2 4 24.474999999999998 33.324999999999996 19.75 22.45 5 25.674999999999997 35.15 22.725 16.45 6 18.5 38.475 23.45 19.575 7 16.025 17.7 45.225 21.05 8 19.325 22.875 29.175 28.625 9 19.475 22.8 32.975 24.75 10 18.375 39.625 24.45 17.549999999999997 11 27.075 27.55 20.825 24.55 12 20.549999999999997 24.775 29.375 25.3 13 21.325 29.2 28.875 20.599999999999998 14 20.375 27.725 29.95 21.95 15 20.825 28.249999999999996 28.875 22.05 16 20.9 27.35 28.449999999999996 23.3 17 21.85 27.675 27.474999999999998 23.0 18 22.35 29.299999999999997 26.525 21.825 19 21.95 28.849999999999998 26.450000000000003 22.75 20 21.65 28.125 28.000000000000004 22.225 21 21.2 28.825 27.800000000000004 22.175 22 20.474999999999998 28.375 28.575 22.575 23 21.349999999999998 28.075 27.700000000000003 22.875 24 21.099999999999998 27.725 29.15 22.025 25 21.735867933966986 28.16408204102051 28.064032016008007 22.0360180090045 26 23.65 28.175 26.674999999999997 21.5 27 21.61080540270135 29.814907453726864 26.96348174087044 21.61080540270135 28 22.5 26.025 28.95 22.525000000000002 29 22.025 28.349999999999998 27.224999999999998 22.400000000000002 30 20.575 29.825000000000003 28.1 21.5 31 22.525000000000002 28.999999999999996 26.674999999999997 21.8 32 22.575 29.049999999999997 27.450000000000003 20.925 33 22.325 28.000000000000004 26.5 23.175 34 21.375 29.049999999999997 27.650000000000002 21.925 35 22.650000000000002 28.249999999999996 27.625 21.475 36 22.425 29.15 26.474999999999998 21.95 37 20.95 28.675 27.800000000000004 22.575 38 23.200000000000003 28.65 26.75 21.4 39 21.825 28.275 27.275 22.625 40 22.25 27.650000000000002 26.825 23.275000000000002 41 21.5607803901951 29.33966983491746 26.76338169084542 22.336168084042022 42 21.2 27.975 29.375 21.45 43 22.85 27.625 27.625 21.9 44 22.2 27.675 28.299999999999997 21.825 45 22.45 27.150000000000002 27.625 22.775000000000002 46 22.35 27.725 27.925 22.0 47 22.825 28.249999999999996 27.224999999999998 21.7 48 21.125 28.199999999999996 28.125 22.55 49 21.375 28.125 28.000000000000004 22.5 50 21.825 27.725 28.825 21.625 51 21.45 28.475 27.700000000000003 22.375 52 22.875 27.525 26.650000000000002 22.95 53 21.3 29.2 28.375 21.125 54 21.625 28.449999999999996 27.950000000000003 21.975 55 21.975 28.249999999999996 28.975 20.8 56 22.1 28.875 27.250000000000004 21.775 57 22.825 28.175 27.750000000000004 21.25 58 22.275 27.925 27.650000000000002 22.15 59 22.175 28.525 27.800000000000004 21.5 60 21.325 28.15 28.999999999999996 21.525 61 22.075 26.875 29.475 21.575 62 22.0 27.474999999999998 28.175 22.35 63 21.55 29.9 27.474999999999998 21.075 64 22.45 27.025 28.599999999999998 21.925 65 21.85 28.449999999999996 28.000000000000004 21.7 66 20.849999999999998 27.800000000000004 28.775000000000002 22.575 67 20.150000000000002 27.6 28.449999999999996 23.799999999999997 68 22.175 28.275 27.224999999999998 22.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 1.0 17 1.5 18 4.0 19 6.0 20 5.5 21 8.0 22 11.0 23 10.0 24 13.0 25 17.0 26 17.5 27 24.0 28 30.0 29 38.5 30 57.0 31 67.0 32 70.5 33 82.0 34 90.0 35 103.0 36 154.5 37 193.0 38 208.0 39 240.5 40 291.0 41 324.0 42 333.0 43 339.0 44 336.0 45 340.0 46 322.0 47 300.0 48 298.0 49 252.5 50 209.0 51 199.0 52 153.5 53 118.0 54 110.5 55 91.5 56 80.0 57 62.0 58 44.5 59 45.0 60 36.5 61 24.0 62 20.0 63 18.0 64 11.0 65 7.0 66 8.0 67 5.0 68 2.0 69 2.0 70 3.0 71 3.5 72 3.0 73 3.5 74 3.5 75 3.0 76 2.5 77 1.5 78 1.0 79 0.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.05 26 0.0 27 0.05 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.05 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.17548257708698922 0.35000000000000003 3 0.0501378791677112 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209018 spots for SRR3207744.sra Written 209018 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra Read 209014 spots for SRR3207744.sra Written 209014 spots for SRR3207744.sra SRR ids: ['SRR3207744.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4pxrkhgm SRR3207744.sra spots: 4180284 blocks: [[1, 209014], [209015, 418028], [418029, 627042], [627043, 836056], [836057, 1045070], [1045071, 1254084], [1254085, 1463098], [1463099, 1672112], [1672113, 1881126], [1881127, 2090140], [2090141, 2299154], [2299155, 2508168], [2508169, 2717182], [2717183, 2926196], [2926197, 3135210], [3135211, 3344224], [3344225, 3553238], [3553239, 3762252], [3762253, 3971266], [3971267, 4180284]] SRR3207744 file size 877404 SRR3207744 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207744 SRR3207744_1.fastq Input file: SRR3207744_1.fastq trimmed: SRR3207744-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 18:32:41 2025 >> started Mon Feb 10 18:32:44 2025 >> done (2.641s) 4180284 reads processed; of these: 8377 ( 0.20%) short reads filtered out after trimming by size control 6186 ( 0.15%) empty reads filtered out after trimming by size control 4165721 (99.65%) reads available; of these: 605752 (14.54%) trimmed reads available after processing 3559969 (85.46%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1282 0.03% 19 2162 0.05% 20 3923 0.09% 21 1283 0.03% 22 1928 0.05% 23 2971 0.07% 24 5008 0.12% 25 8401 0.20% 26 2192 0.05% 27 2845 0.07% 28 3818 0.09% 29 5972 0.14% 30 9025 0.22% 31 2581 0.06% 32 3510 0.08% 33 3802 0.09% 34 6032 0.14% 35 9520 0.23% 36 2892 0.07% 37 3812 0.09% 38 5654 0.14% 39 9048 0.22% 40 14344 0.34% 41 3863 0.09% 42 5043 0.12% 43 7381 0.18% 44 12338 0.30% 45 19012 0.46% 46 5065 0.12% 47 6713 0.16% 48 9844 0.24% 49 16473 0.40% 50 25572 0.61% 51 6466 0.16% 52 8569 0.21% 53 12725 0.31% 54 20611 0.49% 55 33905 0.81% 56 8341 0.20% 57 11258 0.27% 58 16919 0.41% 59 28116 0.67% 60 47885 1.15% 61 11396 0.27% 62 15369 0.37% 63 22287 0.54% 64 35594 0.85% 65 56826 1.36% 66 14921 0.36% 67 31255 0.75% 68 3559969 85.46% 4165721 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=26 prefix-density=0.08 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=119.44 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.8 sequence=TTGCTGCTGTTCTAATGCAAACTTAACAGGCATTTGTTACTTCCAGTGCCCTCAATTCAAACAAAATTTCACACATTTTCACACCAGCACTGGGAACAAAATGCGAAGGATAAGAAAAACCAAAGG Started job on | Feb 10 18:32:56 Started mapping on | Feb 10 18:32:56 Finished on | Feb 10 18:33:02 Mapping speed, Million of reads per hour | 2499.43 Number of input reads | 4165721 Average input read length | 65 UNIQUE READS: Uniquely mapped reads number | 3721989 Uniquely mapped reads % | 89.35% Average mapped length | 66.07 Number of splices: Total | 637044 Number of splices: Annotated (sjdb) | 624901 Number of splices: GT/AG | 627082 Number of splices: GC/AG | 8118 Number of splices: AT/AC | 727 Number of splices: Non-canonical | 1117 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 147054 % of reads mapped to multiple loci | 3.53% Number of reads mapped to too many loci | 264848 % of reads mapped to too many loci | 6.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.75% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 296678 296678 296678 N_multimapping 147054 147054 147054 N_noFeature 250573 1966080 1979145 N_ambiguous 40806 6724 6804 UnstrandedReadsAssigned:3430610 PositiveStrandReadsAssigned:1749185 NegativeStrandReadsAssigned:1736040 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207744 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207744-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,165,721 reads, 3,713,894 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR3207744.ke.tsv 34699 SRR3207744.se.tsv 87100 total ==> SRR3207744.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 168 34.3132 Potri.005G024800.1.v4.1 1035 936 38 15.9124 Potri.004G059700.1.v4.1 961 862 3 1.36408 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 74.8341 10.3133 Potri.016G087400.1.v4.1 270 171 97 222.332 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 12 2.80965 Potri.012G127500.1.v4.1 977 878 404 180.349 ==> SRR3207744.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 528 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 73 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR3207744 completed mapping pipeline successfully