Starting /dee2/code/volunteer_pipeline.sh SRR3207745 current disk space = 3057276985344 free memory = 1578866288 SRR3207745 SRAfilesize a80c5a7ff91d3bfe4f4602ee3a285a84 SRR3207745.sra SRR3207745.sra file validated SRR3207745 is single end SRR3207745 is conventional basespace SRR3207745 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207745_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.13725 39.0 36.0 40.0 31.0 40.0 2 36.05175 38.0 36.0 40.0 30.0 40.0 3 35.98725 38.0 36.0 40.0 30.0 40.0 4 36.032 38.0 36.0 39.0 30.0 40.0 5 36.00225 38.0 36.0 40.0 30.0 40.0 6 36.14375 38.0 35.0 40.0 30.0 40.0 7 36.22375 38.0 36.0 40.0 30.0 40.0 8 36.12025 38.0 35.0 40.0 30.0 40.0 9 36.153 38.0 35.0 40.0 30.0 40.0 10 36.071 38.0 35.0 40.0 29.0 40.0 11 36.535 38.0 35.0 39.0 31.0 40.0 12 36.30825 38.0 35.0 39.0 31.0 40.0 13 36.2935 38.0 35.0 39.0 31.0 40.0 14 36.19675 38.0 35.0 39.0 31.0 40.0 15 36.19125 38.0 35.0 39.0 30.0 40.0 16 36.20575 38.0 35.0 39.0 31.0 40.0 17 36.074 38.0 35.0 39.0 30.0 40.0 18 36.0185 38.0 35.0 39.0 30.0 40.0 19 36.12025 38.0 35.0 39.0 31.0 40.0 20 36.01325 38.0 35.0 39.0 30.0 40.0 21 35.897 38.0 35.0 39.0 30.0 40.0 22 35.8135 38.0 35.0 39.0 30.0 40.0 23 35.6005 38.0 35.0 39.0 29.0 40.0 24 35.46825 38.0 34.0 39.0 29.0 40.0 25 35.478 38.0 34.0 39.0 29.0 40.0 26 35.03575 38.0 33.0 39.0 28.0 40.0 27 34.90475 38.0 33.0 39.0 27.0 40.0 28 34.8135 38.0 33.0 39.0 27.0 40.0 29 34.6705 38.0 33.0 39.0 27.0 40.0 30 34.50725 37.0 33.0 39.0 27.0 40.0 31 34.88025 38.0 33.0 39.0 27.0 40.0 32 34.752 38.0 33.0 39.0 27.0 40.0 33 34.727 38.0 33.0 39.0 27.0 40.0 34 34.6965 38.0 33.0 39.0 27.0 40.0 35 34.603 38.0 33.0 39.0 27.0 40.0 36 34.772 38.0 34.0 39.0 27.0 40.0 37 34.59675 37.0 33.0 39.0 27.0 40.0 38 34.50775 37.0 33.0 39.0 27.0 40.0 39 34.277 37.0 33.0 39.0 27.0 40.0 40 34.15275 37.0 33.0 39.0 26.0 40.0 41 34.155 37.0 33.0 39.0 27.0 40.0 42 33.87025 37.0 33.0 39.0 26.0 40.0 43 33.82175 36.0 33.0 39.0 26.0 40.0 44 33.53625 36.0 32.0 39.0 25.0 40.0 45 33.246 36.0 32.0 39.0 23.0 40.0 46 33.2465 36.0 32.0 39.0 23.0 40.0 47 32.9665 36.0 32.0 39.0 23.0 39.0 48 32.7335 36.0 31.0 39.0 23.0 39.0 49 32.62875 36.0 31.0 39.0 23.0 39.0 50 32.47975 36.0 31.0 39.0 22.0 39.0 51 32.123 36.0 31.0 38.0 19.0 39.0 52 31.9545 35.0 31.0 38.0 18.0 39.0 53 31.72775 35.0 31.0 38.0 18.0 39.0 54 31.5935 35.0 31.0 38.0 17.0 39.0 55 31.34325 35.0 31.0 38.0 16.0 39.0 56 30.956 35.0 30.0 38.0 2.0 39.0 57 30.7045 35.0 30.0 38.0 2.0 39.0 58 30.46275 34.0 29.0 38.0 2.0 39.0 59 30.29 34.0 29.0 38.0 2.0 39.0 60 29.4795 33.0 29.0 36.0 2.0 39.0 61 29.23975 34.0 29.0 37.0 2.0 39.0 62 28.88225 33.0 28.0 36.0 2.0 39.0 63 28.72275 33.0 28.0 36.0 2.0 39.0 64 28.4995 33.0 27.0 36.0 2.0 39.0 65 28.087 33.0 27.0 36.0 2.0 38.0 66 27.539 33.0 26.0 36.0 2.0 38.0 67 27.31025 33.0 25.0 36.0 2.0 38.0 68 26.57475 32.0 23.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 0.0 4 0.0 5 2.0 6 1.0 7 8.0 8 2.0 9 2.0 10 7.0 11 6.0 12 12.0 13 14.0 14 13.0 15 15.0 16 13.0 17 26.0 18 24.0 19 28.0 20 27.0 21 37.0 22 32.0 23 38.0 24 45.0 25 54.0 26 64.0 27 75.0 28 92.0 29 104.0 30 109.0 31 132.0 32 166.0 33 223.0 34 260.0 35 369.0 36 481.0 37 610.0 38 597.0 39 285.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.90231831206043 14.743422766345402 18.520448033342017 41.833810888252145 2 18.0 27.450000000000003 35.05 19.5 3 21.75 30.725 25.7 21.825 4 24.075 35.6 19.775000000000002 20.549999999999997 5 23.375 36.225 22.275 18.125 6 17.75 39.4 23.0 19.85 7 15.625 17.599999999999998 45.125 21.65 8 20.375 23.599999999999998 28.325 27.700000000000003 9 19.7 22.5 31.775 26.025 10 19.85 39.6 23.375 17.175 11 25.874999999999996 27.875 19.325 26.924999999999997 12 20.7 25.025 28.475 25.8 13 19.85 28.799999999999997 30.175 21.175 14 20.625 28.525 28.999999999999996 21.85 15 20.625 28.549999999999997 27.575 23.25 16 21.725 28.849999999999998 27.150000000000002 22.275 17 21.224999999999998 29.375 27.875 21.525 18 21.125 29.7 26.375 22.8 19 21.2 29.025000000000002 28.525 21.25 20 21.025 29.75 26.25 22.975 21 21.675 29.475 27.525 21.325 22 21.75 29.625 26.450000000000003 22.175 23 22.35 28.95 26.575 22.125 24 21.675 30.425 27.05 20.849999999999998 25 21.2 29.7 27.425 21.675 26 21.525 30.325000000000003 26.05 22.1 27 22.55 28.549999999999997 26.875 22.025 28 23.0 29.099999999999998 26.474999999999998 21.425 29 22.15 29.075 27.275 21.5 30 21.175 30.275000000000002 26.325 22.225 31 20.7 28.799999999999997 28.125 22.375 32 21.075 31.3 25.650000000000002 21.975 33 21.925 29.125 27.725 21.224999999999998 34 20.65 28.449999999999996 28.299999999999997 22.6 35 21.65 28.825 27.875 21.65 36 22.2 28.349999999999998 27.625 21.825 37 21.325 28.375 28.749999999999996 21.55 38 22.25 28.000000000000004 28.625 21.125 39 22.225 29.225 26.6 21.95 40 21.25 28.849999999999998 27.575 22.325 41 21.625 29.025000000000002 28.4 20.95 42 21.25 28.549999999999997 27.700000000000003 22.5 43 20.5 28.575 29.275000000000002 21.65 44 21.349999999999998 28.799999999999997 28.225 21.625 45 20.375 29.125 28.999999999999996 21.5 46 21.55 28.125 28.325 22.0 47 21.5 29.5 27.35 21.65 48 23.125 27.825 27.575 21.475 49 21.0 28.925 27.625 22.45 50 21.975 29.325000000000003 27.525 21.175 51 22.55 29.049999999999997 27.400000000000002 21.0 52 22.175 29.575000000000003 27.150000000000002 21.099999999999998 53 22.35 28.625 26.55 22.475 54 20.9 28.425 29.299999999999997 21.375 55 20.95 28.425 28.449999999999996 22.175 56 21.475 28.625 28.249999999999996 21.65 57 21.025 28.249999999999996 28.549999999999997 22.175 58 21.925 28.349999999999998 29.049999999999997 20.674999999999997 59 22.0 29.15 28.025 20.825 60 21.85 28.4 27.750000000000004 22.0 61 21.25 28.875 27.525 22.35 62 22.175 29.075 27.025 21.725 63 22.15 28.775000000000002 27.825 21.25 64 22.025 28.799999999999997 27.175 22.0 65 21.2 27.800000000000004 27.650000000000002 23.35 66 20.8 28.9 28.4 21.9 67 21.675 28.175 27.625 22.525000000000002 68 21.75 28.1 28.499999999999996 21.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.5 18 2.0 19 3.0 20 2.5 21 3.5 22 5.0 23 5.0 24 11.0 25 17.0 26 13.0 27 16.5 28 24.0 29 31.0 30 43.5 31 49.0 32 70.5 33 108.0 34 124.0 35 142.5 36 189.5 37 218.0 38 234.0 39 274.5 40 304.5 41 310.0 42 335.5 43 347.5 44 334.0 45 324.0 46 308.5 47 303.0 48 297.5 49 254.0 50 216.0 51 186.5 52 131.5 53 106.0 54 104.5 55 80.5 56 58.0 57 59.5 58 42.0 59 23.0 60 23.5 61 17.5 62 11.0 63 10.5 64 8.0 65 3.5 66 1.0 67 3.0 68 3.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.5 74 1.0 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.075 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.075 0.0 0.0 0.0 0.0 56 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586378 spots for SRR3207745.sra Written 586378 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra Read 586364 spots for SRR3207745.sra Written 586364 spots for SRR3207745.sra SRR ids: ['SRR3207745.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iofubvid SRR3207745.sra spots: 11727294 blocks: [[1, 586364], [586365, 1172728], [1172729, 1759092], [1759093, 2345456], [2345457, 2931820], [2931821, 3518184], [3518185, 4104548], [4104549, 4690912], [4690913, 5277276], [5277277, 5863640], [5863641, 6450004], [6450005, 7036368], [7036369, 7622732], [7622733, 8209096], [8209097, 8795460], [8795461, 9381824], [9381825, 9968188], [9968189, 10554552], [10554553, 11140916], [11140917, 11727294]] SRR3207745 file size 2465110 SRR3207745 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207745 SRR3207745_1.fastq Input file: SRR3207745_1.fastq trimmed: SRR3207745-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 18:55:56 2025 >> started Mon Feb 10 18:56:02 2025 >> done (5.840s) 11727294 reads processed; of these: 21705 ( 0.19%) short reads filtered out after trimming by size control 19620 ( 0.17%) empty reads filtered out after trimming by size control 11685969 (99.65%) reads available; of these: 1548231 (13.25%) trimmed reads available after processing 10137738 (86.75%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3161 0.03% 19 5493 0.05% 20 9290 0.08% 21 3047 0.03% 22 4494 0.04% 23 6960 0.06% 24 12100 0.10% 25 19991 0.17% 26 5176 0.04% 27 6375 0.05% 28 8992 0.08% 29 14208 0.12% 30 21173 0.18% 31 6118 0.05% 32 8091 0.07% 33 9233 0.08% 34 14267 0.12% 35 22362 0.19% 36 6921 0.06% 37 9170 0.08% 38 13315 0.11% 39 21085 0.18% 40 33959 0.29% 41 9177 0.08% 42 11969 0.10% 43 17440 0.15% 44 29460 0.25% 45 46438 0.40% 46 12819 0.11% 47 16647 0.14% 48 23755 0.20% 49 40545 0.35% 50 64535 0.55% 51 16389 0.14% 52 21662 0.19% 53 32654 0.28% 54 52660 0.45% 55 87144 0.75% 56 21918 0.19% 57 29584 0.25% 58 44366 0.38% 59 73793 0.63% 60 126896 1.09% 61 29771 0.25% 62 40662 0.35% 63 58685 0.50% 64 95431 0.82% 65 154067 1.32% 66 40029 0.34% 67 84754 0.73% 68 10137738 86.75% 11685969 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=34.72 fanout-score-rank=9 prefix-density=0.13 prefix-fanout=9.2 sequence=CACCAGCACCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=18 fanout-score=161.45 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.7 sequence=TTCTTCTTCTTC Started job on | Feb 10 18:56:17 Started mapping on | Feb 10 18:56:18 Finished on | Feb 10 18:56:29 Mapping speed, Million of reads per hour | 3824.50 Number of input reads | 11685969 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 11087815 Uniquely mapped reads % | 94.88% Average mapped length | 66.05 Number of splices: Total | 2035663 Number of splices: Annotated (sjdb) | 2002200 Number of splices: GT/AG | 2006120 Number of splices: GC/AG | 24132 Number of splices: AT/AC | 2282 Number of splices: Non-canonical | 3129 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380651 % of reads mapped to multiple loci | 3.26% Number of reads mapped to too many loci | 156796 % of reads mapped to too many loci | 1.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 217503 217503 217503 N_multimapping 380651 380651 380651 N_noFeature 554000 5766639 5796856 N_ambiguous 114681 18095 18388 UnstrandedReadsAssigned:10419134 PositiveStrandReadsAssigned:5303081 NegativeStrandReadsAssigned:5272571 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207745 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207745-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,685,969 reads, 10,720,155 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,245 rounds 52401 SRR3207745.ke.tsv 34699 SRR3207745.se.tsv 87100 total ==> SRR3207745.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 312 23.3446 Potri.005G024800.1.v4.1 1035 936 46 7.05649 Potri.004G059700.1.v4.1 961 862 6 0.999426 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 170.703 8.61823 Potri.016G087400.1.v4.1 270 171 357 299.764 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 34 2.91629 Potri.012G127500.1.v4.1 977 878 1054 172.366 ==> SRR3207745.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1474 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 193 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 26 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR3207745 completed mapping pipeline successfully