Starting /dee2/code/volunteer_pipeline.sh SRR3207746 current disk space = 3057617874944 free memory = 1098313504 SRR3207746 SRAfilesize 4c86e9d15f65c954b1723746f53c4cbc SRR3207746.sra SRR3207746.sra file validated SRR3207746 is single end SRR3207746 is conventional basespace SRR3207746 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207746_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.7475 38.0 37.0 40.0 33.0 40.0 2 36.46275 38.0 36.0 40.0 31.0 40.0 3 36.41325 38.0 36.0 40.0 31.0 40.0 4 36.29525 38.0 36.0 40.0 30.0 40.0 5 36.3665 38.0 36.0 40.0 31.0 40.0 6 36.54825 38.0 36.0 40.0 31.0 40.0 7 36.48475 38.0 36.0 40.0 31.0 40.0 8 36.32975 38.0 35.0 40.0 30.0 40.0 9 36.35525 38.0 35.0 40.0 31.0 40.0 10 36.405 38.0 35.0 40.0 31.0 40.0 11 36.499 38.0 35.0 40.0 31.0 40.0 12 36.3185 38.0 35.0 40.0 31.0 40.0 13 36.21875 38.0 35.0 40.0 31.0 40.0 14 36.2555 38.0 35.0 40.0 31.0 40.0 15 36.241 38.0 35.0 39.0 30.0 40.0 16 36.3045 38.0 35.0 39.0 31.0 40.0 17 36.0185 38.0 35.0 39.0 30.0 40.0 18 36.021 38.0 35.0 39.0 30.0 40.0 19 36.0585 38.0 35.0 39.0 30.0 40.0 20 35.92725 38.0 35.0 39.0 30.0 40.0 21 35.9615 38.0 35.0 39.0 30.0 40.0 22 35.85675 38.0 35.0 39.0 30.0 40.0 23 35.722 38.0 35.0 39.0 29.0 40.0 24 35.5555 38.0 35.0 39.0 29.0 40.0 25 35.4655 38.0 34.0 39.0 29.0 40.0 26 35.076 38.0 34.0 39.0 28.0 40.0 27 34.892 38.0 33.0 39.0 27.0 40.0 28 34.91625 38.0 33.0 39.0 27.0 40.0 29 34.669 38.0 33.0 39.0 27.0 40.0 30 34.46575 38.0 33.0 39.0 27.0 40.0 31 34.8245 38.0 34.0 39.0 27.0 40.0 32 34.79275 38.0 33.0 39.0 27.0 40.0 33 34.81775 38.0 33.0 39.0 27.0 40.0 34 34.69125 38.0 33.0 39.0 27.0 40.0 35 34.65275 38.0 33.0 39.0 27.0 40.0 36 34.80675 38.0 34.0 39.0 27.0 40.0 37 34.57225 38.0 33.0 39.0 27.0 40.0 38 34.532 38.0 33.0 39.0 27.0 40.0 39 34.28075 37.0 33.0 39.0 26.0 40.0 40 34.1115 37.0 33.0 39.0 26.0 40.0 41 34.09825 37.0 33.0 39.0 26.0 40.0 42 33.80825 37.0 33.0 39.0 25.0 40.0 43 33.73075 37.0 33.0 39.0 26.0 40.0 44 33.5695 36.0 33.0 39.0 24.0 40.0 45 33.29875 36.0 33.0 39.0 23.0 40.0 46 33.165 36.0 32.0 39.0 23.0 40.0 47 32.8405 36.0 32.0 39.0 23.0 40.0 48 32.66075 36.0 32.0 39.0 22.0 39.0 49 32.59575 36.0 32.0 39.0 22.0 39.0 50 32.40975 36.0 31.0 39.0 21.0 39.0 51 32.11575 36.0 31.0 38.0 18.0 39.0 52 31.6745 35.0 31.0 38.0 16.0 39.0 53 31.6895 35.0 31.0 38.0 16.0 39.0 54 31.55125 35.0 31.0 38.0 16.0 39.0 55 31.273 35.0 31.0 38.0 11.0 39.0 56 30.70175 35.0 30.0 38.0 2.0 39.0 57 30.3125 35.0 29.0 38.0 2.0 39.0 58 30.04775 34.0 29.0 38.0 2.0 39.0 59 29.99025 34.0 29.0 38.0 2.0 39.0 60 29.08875 33.0 28.0 36.0 2.0 39.0 61 29.05775 34.0 28.0 37.0 2.0 39.0 62 28.739 33.0 27.0 37.0 2.0 39.0 63 28.5855 33.0 27.0 36.0 2.0 39.0 64 28.357 33.0 28.0 36.0 2.0 39.0 65 28.0045 33.0 27.0 36.0 2.0 39.0 66 27.312 33.0 25.0 36.0 2.0 38.0 67 27.13175 33.0 24.0 36.0 2.0 38.0 68 26.52275 33.0 23.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 0.0 4 0.0 5 0.0 6 3.0 7 1.0 8 3.0 9 7.0 10 15.0 11 12.0 12 7.0 13 12.0 14 15.0 15 16.0 16 18.0 17 16.0 18 31.0 19 18.0 20 25.0 21 44.0 22 34.0 23 43.0 24 48.0 25 42.0 26 68.0 27 85.0 28 70.0 29 93.0 30 115.0 31 114.0 32 147.0 33 210.0 34 300.0 35 348.0 36 472.0 37 585.0 38 643.0 39 307.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.848515864892526 15.86489252814739 20.03582395087001 40.25076765609007 2 18.8 24.6 37.574999999999996 19.025 3 21.75 29.2 27.0 22.05 4 24.025 34.425 20.525 21.025 5 24.275 36.7 22.3 16.725 6 18.025 37.325 24.2 20.45 7 16.725 17.150000000000002 44.925 21.2 8 19.625 23.1 28.549999999999997 28.725 9 18.425 23.225 31.6 26.75 10 17.5 41.349999999999994 22.75 18.4 11 25.874999999999996 28.325 21.224999999999998 24.575 12 20.375 24.825 27.3 27.500000000000004 13 18.425 29.049999999999997 30.65 21.875 14 21.6 27.474999999999998 29.549999999999997 21.375 15 20.575 28.65 28.449999999999996 22.325 16 21.0 27.675 28.95 22.375 17 22.425 28.95 27.150000000000002 21.475 18 21.0 29.625 26.775 22.6 19 22.125 27.875 27.450000000000003 22.55 20 22.325 29.275000000000002 27.6 20.8 21 21.275 27.425 28.199999999999996 23.1 22 20.3 29.275000000000002 28.599999999999998 21.825 23 21.575 28.375 28.249999999999996 21.8 24 22.05 28.325 27.175 22.45 25 20.825 28.725 28.4 22.05 26 22.2 28.625 26.6 22.575 27 21.75 29.025000000000002 27.150000000000002 22.075 28 21.475 26.724999999999998 28.925 22.875 29 22.475 27.224999999999998 28.65 21.65 30 21.475 29.049999999999997 27.400000000000002 22.075 31 20.75 28.199999999999996 28.050000000000004 23.0 32 21.15 28.7 28.599999999999998 21.55 33 21.2 28.475 28.4 21.925 34 21.3 28.050000000000004 28.15 22.5 35 22.650000000000002 28.499999999999996 27.700000000000003 21.15 36 20.9 29.2 27.700000000000003 22.2 37 21.5 29.525000000000002 27.525 21.45 38 21.075 28.025 27.675 23.225 39 20.724999999999998 28.9 28.175 22.2 40 22.225 27.6 28.225 21.95 41 22.325 28.275 27.750000000000004 21.65 42 21.825 29.049999999999997 28.325 20.8 43 21.575 27.925 28.625 21.875 44 21.05 29.075 28.025 21.85 45 21.4 28.349999999999998 27.650000000000002 22.6 46 22.725 27.950000000000003 26.974999999999998 22.35 47 22.675 28.375 27.525 21.425 48 20.875 28.95 28.249999999999996 21.925 49 22.0 27.55 27.35 23.1 50 21.95 29.599999999999998 27.0 21.45 51 22.45 27.474999999999998 27.85 22.225 52 21.075 30.425 27.05 21.45 53 22.5 29.5 27.05 20.95 54 21.8 27.750000000000004 28.199999999999996 22.25 55 20.599999999999998 28.575 28.275 22.55 56 21.475 29.2 27.675 21.65 57 22.25 27.825 28.299999999999997 21.625 58 22.125 28.199999999999996 27.325 22.35 59 22.425 29.425 27.525 20.625 60 21.275 28.9 27.474999999999998 22.35 61 20.674999999999997 27.675 28.749999999999996 22.900000000000002 62 21.375 28.1 28.125 22.400000000000002 63 22.2 28.225 28.325 21.25 64 22.125 28.15 27.85 21.875 65 22.275 28.625 26.575 22.525000000000002 66 20.775 27.950000000000003 29.45 21.825 67 21.099999999999998 28.549999999999997 28.375 21.975 68 22.95 28.050000000000004 27.575 21.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 0.5 19 1.0 20 1.0 21 3.5 22 6.0 23 5.0 24 7.0 25 10.0 26 15.5 27 23.5 28 26.0 29 35.0 30 54.0 31 64.0 32 75.5 33 94.5 34 102.0 35 127.5 36 182.0 37 211.0 38 214.5 39 260.0 40 317.0 41 332.0 42 328.5 43 338.5 44 352.0 45 356.5 46 335.5 47 310.0 48 288.0 49 234.0 50 202.0 51 186.5 52 149.0 53 127.0 54 109.0 55 80.0 56 69.0 57 57.0 58 34.5 59 24.0 60 22.0 61 16.5 62 13.0 63 10.5 64 8.5 65 7.5 66 6.0 67 5.0 68 4.5 69 5.0 70 3.5 71 2.0 72 2.0 73 1.0 74 1.0 75 2.0 76 1.5 77 0.5 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89987484355444 99.775 2 0.0750938673341677 0.15 3 0.025031289111389236 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339706 spots for SRR3207746.sra Written 339706 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra Read 339703 spots for SRR3207746.sra Written 339703 spots for SRR3207746.sra SRR ids: ['SRR3207746.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7gzv0ftz SRR3207746.sra spots: 6794063 blocks: [[1, 339703], [339704, 679406], [679407, 1019109], [1019110, 1358812], [1358813, 1698515], [1698516, 2038218], [2038219, 2377921], [2377922, 2717624], [2717625, 3057327], [3057328, 3397030], [3397031, 3736733], [3736734, 4076436], [4076437, 4416139], [4416140, 4755842], [4755843, 5095545], [5095546, 5435248], [5435249, 5774951], [5774952, 6114654], [6114655, 6454357], [6454358, 6794063]] SRR3207746 file size 1426704 SRR3207746 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207746 SRR3207746_1.fastq Input file: SRR3207746_1.fastq trimmed: SRR3207746-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 18:18:51 2025 >> started Mon Feb 10 18:18:54 2025 >> done (3.252s) 6794063 reads processed; of these: 11998 ( 0.18%) short reads filtered out after trimming by size control 6941 ( 0.10%) empty reads filtered out after trimming by size control 6775124 (99.72%) reads available; of these: 881721 (13.01%) trimmed reads available after processing 5893403 (86.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1758 0.03% 19 3102 0.05% 20 5269 0.08% 21 1667 0.02% 22 2483 0.04% 23 3953 0.06% 24 6637 0.10% 25 11132 0.16% 26 3048 0.04% 27 3573 0.05% 28 5174 0.08% 29 7664 0.11% 30 11918 0.18% 31 3382 0.05% 32 4613 0.07% 33 5130 0.08% 34 7952 0.12% 35 12800 0.19% 36 3903 0.06% 37 5193 0.08% 38 7523 0.11% 39 11939 0.18% 40 19022 0.28% 41 5060 0.07% 42 6707 0.10% 43 10217 0.15% 44 16813 0.25% 45 26802 0.40% 46 7096 0.10% 47 9652 0.14% 48 13461 0.20% 49 22991 0.34% 50 37097 0.55% 51 9417 0.14% 52 12253 0.18% 53 18637 0.28% 54 30346 0.45% 55 49463 0.73% 56 12501 0.18% 57 16514 0.24% 58 24897 0.37% 59 42307 0.62% 60 72097 1.06% 61 16940 0.25% 62 22955 0.34% 63 33485 0.49% 64 54977 0.81% 65 88489 1.31% 66 22735 0.34% 67 48977 0.72% 68 5893403 86.99% 6775124 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=26 prefix-density=0.04 prefix-fanout=2.4 sequence=GGTGCAAAGATGGTTA criterion=fanout-score sequence-density=0.03 sequence-density-rank=13 fanout-score=89.97 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=14.6 sequence=CTTCTTCTTCTT Started job on | Feb 10 18:19:10 Started mapping on | Feb 10 18:19:10 Finished on | Feb 10 18:19:16 Mapping speed, Million of reads per hour | 4065.07 Number of input reads | 6775124 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 6454686 Uniquely mapped reads % | 95.27% Average mapped length | 66.08 Number of splices: Total | 1177628 Number of splices: Annotated (sjdb) | 1158579 Number of splices: GT/AG | 1160632 Number of splices: GC/AG | 14017 Number of splices: AT/AC | 1190 Number of splices: Non-canonical | 1789 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.01% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 220857 % of reads mapped to multiple loci | 3.26% Number of reads mapped to too many loci | 68488 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 99581 99581 99581 N_multimapping 220857 220857 220857 N_noFeature 312339 3355982 3362235 N_ambiguous 69029 9886 10400 UnstrandedReadsAssigned:6073318 PositiveStrandReadsAssigned:3088818 NegativeStrandReadsAssigned:3082051 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207746 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207746-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,775,124 reads, 6,233,114 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,235 rounds 52401 SRR3207746.ke.tsv 34699 SRR3207746.se.tsv 87100 total ==> SRR3207746.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 190 23.6576 Potri.005G024800.1.v4.1 1035 936 20 5.1056 Potri.004G059700.1.v4.1 961 862 12 3.32634 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 90.1008 7.56992 Potri.016G087400.1.v4.1 270 171 198 276.67 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 27 3.8539 Potri.012G127500.1.v4.1 977 878 786 213.905 ==> SRR3207746.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 883 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 119 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207746 completed mapping pipeline successfully