Starting /dee2/code/volunteer_pipeline.sh SRR3207747 current disk space = 3057258553344 free memory = 1018813716 SRR3207747 SRAfilesize 2754735505395b5e83bf922f72a131c0 SRR3207747.sra SRR3207747.sra file validated SRR3207747 is single end SRR3207747 is conventional basespace SRR3207747 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207747_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.6175 39.0 38.0 40.0 33.0 40.0 2 37.29475 39.0 37.0 40.0 33.0 40.0 3 37.289 39.0 37.0 40.0 33.0 40.0 4 37.16575 39.0 37.0 40.0 33.0 40.0 5 37.14725 39.0 37.0 40.0 33.0 40.0 6 37.27925 39.0 37.0 40.0 33.0 40.0 7 37.2125 39.0 37.0 40.0 33.0 40.0 8 37.157 39.0 36.0 40.0 33.0 40.0 9 37.0575 39.0 36.0 40.0 32.0 40.0 10 37.0185 39.0 36.0 40.0 32.0 40.0 11 37.08575 39.0 36.0 40.0 33.0 40.0 12 37.10075 39.0 36.0 40.0 33.0 40.0 13 36.97975 38.0 36.0 40.0 32.0 40.0 14 36.94275 38.0 36.0 40.0 32.0 40.0 15 36.762 38.0 36.0 40.0 31.0 40.0 16 36.84575 38.0 36.0 40.0 32.0 40.0 17 36.7005 38.0 36.0 40.0 31.0 40.0 18 36.604 38.0 35.0 40.0 31.0 40.0 19 36.59825 38.0 35.0 40.0 31.0 40.0 20 36.44925 38.0 35.0 40.0 31.0 40.0 21 36.36475 38.0 35.0 40.0 31.0 40.0 22 36.12125 38.0 35.0 39.0 30.0 40.0 23 36.09875 38.0 35.0 39.0 30.0 40.0 24 35.829 38.0 35.0 39.0 29.0 40.0 25 35.76825 38.0 35.0 39.0 29.0 40.0 26 35.25275 38.0 34.0 39.0 29.0 40.0 27 35.107 38.0 33.0 39.0 28.0 40.0 28 35.09075 38.0 34.0 39.0 28.0 40.0 29 34.823 38.0 33.0 39.0 27.0 40.0 30 34.72125 38.0 33.0 39.0 27.0 40.0 31 34.86975 38.0 34.0 39.0 27.0 40.0 32 34.586 38.0 33.0 39.0 27.0 40.0 33 34.5135 38.0 33.0 39.0 27.0 40.0 34 34.32975 38.0 33.0 39.0 26.0 40.0 35 34.377 38.0 33.0 39.0 27.0 40.0 36 34.622 38.0 34.0 39.0 27.0 40.0 37 34.22175 38.0 33.0 39.0 25.0 40.0 38 34.2755 38.0 33.0 39.0 26.0 40.0 39 34.10025 38.0 33.0 39.0 26.0 40.0 40 33.9565 38.0 33.0 39.0 24.0 40.0 41 33.58825 37.0 33.0 39.0 23.0 40.0 42 33.56475 37.0 33.0 39.0 23.0 40.0 43 33.346 37.0 33.0 39.0 23.0 40.0 44 33.159 37.0 33.0 39.0 23.0 40.0 45 32.95075 36.0 32.0 39.0 23.0 40.0 46 32.623 36.0 32.0 39.0 18.0 40.0 47 32.47825 36.0 32.0 39.0 19.0 40.0 48 32.21575 36.0 31.0 39.0 17.0 40.0 49 31.84375 36.0 31.0 39.0 13.0 40.0 50 31.80475 36.0 31.0 39.0 9.0 40.0 51 31.083 36.0 30.0 39.0 2.0 40.0 52 30.8655 35.0 30.0 39.0 2.0 40.0 53 30.827 35.0 30.0 39.0 2.0 40.0 54 30.22225 35.0 29.0 38.0 2.0 39.0 55 29.944 35.0 29.0 38.0 2.0 40.0 56 29.7125 35.0 29.0 38.0 2.0 39.0 57 29.44675 35.0 28.0 38.0 2.0 39.0 58 29.2315 35.0 28.0 38.0 2.0 39.0 59 28.85425 34.0 27.0 38.0 2.0 39.0 60 28.4485 34.0 27.0 38.0 2.0 39.0 61 27.93375 34.0 25.0 38.0 2.0 39.0 62 27.97575 34.0 25.0 38.0 2.0 39.0 63 27.58375 33.0 25.0 37.0 2.0 39.0 64 27.53625 33.0 24.0 38.0 2.0 39.0 65 27.08025 33.0 23.0 37.0 2.0 39.0 66 26.2035 33.0 18.0 36.0 2.0 39.0 67 25.7305 33.0 17.0 36.0 2.0 39.0 68 25.42675 32.0 15.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 4.0 7 4.0 8 5.0 9 7.0 10 8.0 11 14.0 12 15.0 13 18.0 14 24.0 15 30.0 16 23.0 17 19.0 18 26.0 19 35.0 20 40.0 21 55.0 22 44.0 23 48.0 24 48.0 25 63.0 26 68.0 27 91.0 28 76.0 29 82.0 30 101.0 31 101.0 32 152.0 33 201.0 34 261.0 35 315.0 36 442.0 37 520.0 38 589.0 39 467.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.472068444891793 13.361852038248617 16.834423754403623 43.33165576245596 2 22.030507626906726 20.505126281570394 33.20830207551888 24.256064016004 3 24.5 26.0 24.775 24.725 4 27.625 29.65 18.25 24.474999999999998 5 27.975 31.924999999999997 21.224999999999998 18.875 6 20.599999999999998 35.475 22.525000000000002 21.4 7 17.974999999999998 16.45 42.975 22.6 8 22.3 20.525 26.900000000000002 30.275000000000002 9 22.15 21.775 29.325000000000003 26.75 10 22.225 37.0 20.45 20.325 11 25.7 26.700000000000003 18.9 28.7 12 22.375 23.25 27.35 27.025 13 21.275 26.8 28.349999999999998 23.575 14 22.475 26.200000000000003 26.3 25.025 15 22.400000000000002 26.200000000000003 27.925 23.474999999999998 16 22.75 27.1 25.374999999999996 24.775 17 22.625 27.3 26.825 23.25 18 24.349999999999998 26.700000000000003 24.6 24.349999999999998 19 23.849999999999998 27.150000000000002 25.2 23.799999999999997 20 23.474999999999998 25.95 27.6 22.975 21 23.05 26.375 25.874999999999996 24.7 22 22.95 27.0 25.775 24.275 23 24.075 25.900000000000002 25.85 24.175 24 23.45 26.424999999999997 26.3 23.825 25 22.975 26.75 26.650000000000002 23.625 26 23.1 26.700000000000003 25.85 24.349999999999998 27 25.275 26.974999999999998 24.925 22.825 28 24.55 26.125 25.124999999999996 24.2 29 24.2 27.525 24.375 23.9 30 24.125 26.674999999999997 25.224999999999998 23.974999999999998 31 23.275000000000002 25.974999999999998 26.6 24.15 32 24.65 25.974999999999998 25.75 23.625 33 23.849999999999998 26.724999999999998 24.9 24.525 34 22.8 26.5 25.5 25.2 35 22.875 27.925 25.525 23.674999999999997 36 23.599999999999998 26.75 25.7 23.95 37 24.218163622717036 26.64498373780335 25.143857893420062 23.992994746059544 38 22.575 26.724999999999998 25.900000000000002 24.8 39 24.15 26.775 24.825 24.25 40 23.275000000000002 26.224999999999998 26.200000000000003 24.3 41 24.65 25.35 25.124999999999996 24.875 42 24.099999999999998 25.525 26.275 24.099999999999998 43 24.0180135101326 26.82011508631474 26.019514635976982 23.14235676757568 44 23.474999999999998 26.05 25.55 24.925 45 24.025 26.275 25.8 23.9 46 24.15 25.575 25.75 24.525 47 23.974999999999998 26.6 25.374999999999996 24.05 48 23.724999999999998 26.875 24.9 24.5 49 23.599999999999998 27.450000000000003 26.25 22.7 50 23.849999999999998 25.775 26.025 24.349999999999998 51 22.75 26.55 26.325 24.375 52 25.525 25.55 25.224999999999998 23.7 53 25.775 27.05 24.85 22.325 54 24.425 26.400000000000002 25.45 23.724999999999998 55 23.025000000000002 26.075 25.7 25.2 56 24.075 25.424999999999997 26.0 24.5 57 23.375 26.400000000000002 26.400000000000002 23.825 58 23.9 26.875 26.05 23.175 59 24.575 25.3 25.124999999999996 25.0 60 24.675 26.375 24.525 24.425 61 24.85 25.924999999999997 24.85 24.375 62 24.875 25.174999999999997 26.025 23.925 63 24.525 27.175 24.3 24.0 64 24.099999999999998 26.25 25.525 24.125 65 25.900000000000002 25.224999999999998 24.8 24.075 66 24.05 25.1 25.650000000000002 25.2 67 24.65 26.55 24.45 24.349999999999998 68 23.45 25.35 25.575 25.624999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.5 16 1.0 17 2.5 18 2.5 19 1.0 20 1.5 21 3.5 22 5.0 23 6.0 24 5.5 25 4.0 26 9.0 27 15.0 28 16.0 29 23.0 30 30.0 31 30.0 32 43.5 33 63.5 34 70.0 35 81.0 36 120.5 37 149.0 38 148.5 39 175.0 40 209.5 41 217.0 42 242.5 43 267.5 44 267.0 45 282.5 46 272.5 47 247.0 48 245.0 49 257.5 50 272.0 51 234.5 52 170.0 53 143.0 54 157.0 55 156.0 56 141.0 57 126.0 58 99.0 59 87.0 60 86.5 61 77.0 62 68.0 63 53.0 64 38.5 65 36.5 66 34.0 67 35.0 68 32.0 69 28.0 70 27.5 71 25.5 72 24.0 73 31.0 74 32.0 75 26.0 76 23.0 77 19.0 78 18.0 79 12.5 80 8.0 81 9.0 82 4.5 83 1.0 84 2.0 85 2.5 86 1.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.075 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.075 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.775 #Duplication Level Percentage of deduplicated Percentage of total 1 96.60663012268337 92.525 2 2.688593056643174 5.1499999999999995 3 0.4959540589924301 1.425 4 0.10441138084051162 0.4 5 0.10441138084051162 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGT 5 0.125 No Hit GCGCAGTTGGGCACCGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGG 5 0.125 No Hit CCTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATTTCAAAGATTACCCGGGC 5 0.125 No Hit TCTCAAGTCATTTCACAAAGTCGGACTAGAGTCAAGCTCAACAGGGTCTTCTTTCCCCGCTGATTCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130155 spots for SRR3207747.sra Written 130155 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra Read 130142 spots for SRR3207747.sra Written 130142 spots for SRR3207747.sra SRR ids: ['SRR3207747.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dijcqgc9 SRR3207747.sra spots: 2602853 blocks: [[1, 130142], [130143, 260284], [260285, 390426], [390427, 520568], [520569, 650710], [650711, 780852], [780853, 910994], [910995, 1041136], [1041137, 1171278], [1171279, 1301420], [1301421, 1431562], [1431563, 1561704], [1561705, 1691846], [1691847, 1821988], [1821989, 1952130], [1952131, 2082272], [2082273, 2212414], [2212415, 2342556], [2342557, 2472698], [2472699, 2602853]] SRR3207747 file size 545922 SRR3207747 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207747 SRR3207747_1.fastq Input file: SRR3207747_1.fastq trimmed: SRR3207747-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 18:49:38 2025 >> started Mon Feb 10 18:49:41 2025 >> done (3.477s) 2602853 reads processed; of these: 6038 ( 0.23%) short reads filtered out after trimming by size control 8274 ( 0.32%) empty reads filtered out after trimming by size control 2588541 (99.45%) reads available; of these: 553770 (21.39%) trimmed reads available after processing 2034771 (78.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1288 0.05% 19 2078 0.08% 20 4028 0.16% 21 1322 0.05% 22 1905 0.07% 23 3288 0.13% 24 5803 0.22% 25 9580 0.37% 26 2265 0.09% 27 2834 0.11% 28 3989 0.15% 29 6741 0.26% 30 9672 0.37% 31 2750 0.11% 32 3954 0.15% 33 4034 0.16% 34 6882 0.27% 35 10900 0.42% 36 3329 0.13% 37 4000 0.15% 38 6291 0.24% 39 10470 0.40% 40 16186 0.63% 41 4225 0.16% 42 5726 0.22% 43 8189 0.32% 44 13189 0.51% 45 20475 0.79% 46 5389 0.21% 47 6928 0.27% 48 10265 0.40% 49 16609 0.64% 50 24877 0.96% 51 6631 0.26% 52 8497 0.33% 53 12031 0.46% 54 19871 0.77% 55 29678 1.15% 56 7819 0.30% 57 10091 0.39% 58 14995 0.58% 59 23407 0.90% 60 39504 1.53% 61 9572 0.37% 62 12690 0.49% 63 17428 0.67% 64 27756 1.07% 65 42678 1.65% 66 10821 0.42% 67 20840 0.81% 68 2034771 78.61% 2588541 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=29 prefix-density=0.51 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=16.12 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=1.7 sequence=CGCATCGCCGGTAGAAGGGACGAGGCGACCGGTGCACACCTGAGGCGGACCGGCCGACCCAACCCAAAGTCCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTCCAATTACCAGACTCGAAGAGCCCGGTATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCTCTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGATGCGTCGCCAGCACGAAGGCCGTGCGATCCGTCGAGTTATCATGAATCATCAGAGCAACGGGCAGAGCCCGCGTCGACCTTTTATCTAATAAATGCGTC Started job on | Feb 10 18:49:59 Started mapping on | Feb 10 18:50:00 Finished on | Feb 10 18:50:14 Mapping speed, Million of reads per hour | 665.62 Number of input reads | 2588541 Average input read length | 64 UNIQUE READS: Uniquely mapped reads number | 1433019 Uniquely mapped reads % | 55.36% Average mapped length | 66.32 Number of splices: Total | 246171 Number of splices: Annotated (sjdb) | 239605 Number of splices: GT/AG | 241679 Number of splices: GC/AG | 3618 Number of splices: AT/AC | 287 Number of splices: Non-canonical | 587 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 75280 % of reads mapped to multiple loci | 2.91% Number of reads mapped to too many loci | 972569 % of reads mapped to too many loci | 37.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.12% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1080242 1080242 1080242 N_multimapping 75280 75280 75280 N_noFeature 144254 784272 785682 N_ambiguous 12549 2610 2650 UnstrandedReadsAssigned:1276216 PositiveStrandReadsAssigned:646137 NegativeStrandReadsAssigned:644687 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=65 echo kmer=61 SRR3207747 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207747-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,588,541 reads, 2,092,317 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,040 rounds 52401 SRR3207747.ke.tsv 34699 SRR3207747.se.tsv 87100 total ==> SRR3207747.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 106 32.9359 Potri.005G024800.1.v4.1 1035 936 83 52.8739 Potri.004G059700.1.v4.1 961 862 1 0.691723 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 25.6116 5.36966 Potri.016G087400.1.v4.1 270 171 12 41.8432 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 6 2.13715 Potri.012G127500.1.v4.1 977 878 469 318.506 ==> SRR3207747.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 108 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 29 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207747 completed mapping pipeline successfully