Starting /dee2/code/volunteer_pipeline.sh SRR3207748 current disk space = 3056723259392 free memory = 1484260176 SRR3207748 SRAfilesize f82edcca3c36d60f501895355f40ee02 SRR3207748.sra SRR3207748.sra file validated SRR3207748 is single end SRR3207748 is conventional basespace SRR3207748 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207748_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.52675 39.0 38.0 40.0 33.0 40.0 2 37.28775 39.0 38.0 40.0 33.0 40.0 3 37.25275 39.0 37.0 40.0 33.0 40.0 4 37.23025 39.0 38.0 40.0 33.0 40.0 5 37.2435 39.0 37.0 40.0 33.0 40.0 6 37.28075 39.0 37.0 40.0 33.0 40.0 7 37.2685 39.0 37.0 40.0 33.0 40.0 8 37.083 39.0 36.0 40.0 32.0 40.0 9 37.1565 39.0 37.0 40.0 33.0 40.0 10 37.07625 39.0 36.0 40.0 33.0 40.0 11 37.17175 39.0 36.0 40.0 33.0 40.0 12 37.1855 39.0 36.0 40.0 33.0 40.0 13 37.097 39.0 36.0 40.0 33.0 40.0 14 37.0835 39.0 36.0 40.0 32.0 40.0 15 36.9485 38.0 36.0 40.0 31.0 40.0 16 37.04775 39.0 36.0 40.0 32.0 40.0 17 36.95675 38.0 36.0 40.0 32.0 40.0 18 36.81075 38.0 36.0 40.0 31.0 40.0 19 36.81175 38.0 36.0 40.0 32.0 40.0 20 36.61075 38.0 35.0 40.0 31.0 40.0 21 36.57625 38.0 35.0 40.0 31.0 40.0 22 36.48525 38.0 35.0 40.0 31.0 40.0 23 36.3915 38.0 35.0 40.0 31.0 40.0 24 36.17075 38.0 35.0 40.0 30.0 40.0 25 36.17375 38.0 35.0 40.0 30.0 40.0 26 35.92825 38.0 35.0 39.0 30.0 40.0 27 35.6325 38.0 35.0 39.0 29.0 40.0 28 35.72925 38.0 35.0 39.0 29.0 40.0 29 35.464 38.0 34.0 39.0 29.0 40.0 30 35.4565 38.0 34.0 39.0 29.0 40.0 31 35.52425 38.0 35.0 39.0 29.0 40.0 32 35.39675 38.0 35.0 39.0 29.0 40.0 33 35.4155 38.0 35.0 39.0 29.0 40.0 34 35.233 38.0 34.0 39.0 29.0 40.0 35 35.297 38.0 34.0 39.0 29.0 40.0 36 35.46925 38.0 35.0 39.0 29.0 40.0 37 35.2515 38.0 35.0 39.0 29.0 40.0 38 35.05175 38.0 34.0 39.0 27.0 40.0 39 35.055 38.0 34.0 39.0 28.0 40.0 40 34.9485 38.0 34.0 39.0 28.0 40.0 41 34.50975 38.0 33.0 39.0 27.0 40.0 42 34.5755 38.0 34.0 39.0 27.0 40.0 43 34.51025 38.0 33.0 39.0 27.0 40.0 44 34.29725 38.0 33.0 39.0 27.0 40.0 45 34.07225 37.0 33.0 39.0 26.0 40.0 46 33.99475 38.0 33.0 39.0 25.0 40.0 47 33.781 37.0 33.0 39.0 24.0 40.0 48 33.64575 37.0 33.0 39.0 24.0 40.0 49 33.2305 36.0 33.0 39.0 23.0 40.0 50 33.3585 37.0 33.0 39.0 23.0 40.0 51 32.88325 36.0 32.0 39.0 23.0 40.0 52 32.74375 36.0 32.0 39.0 22.0 40.0 53 32.60925 36.0 32.0 39.0 22.0 40.0 54 32.19175 36.0 31.0 39.0 18.0 40.0 55 32.122 36.0 31.0 39.0 18.0 40.0 56 31.9985 36.0 31.0 39.0 16.0 40.0 57 31.67875 36.0 31.0 39.0 13.0 39.0 58 31.45425 36.0 31.0 38.0 7.0 39.0 59 30.9905 35.0 30.0 38.0 2.0 39.0 60 30.68 35.0 30.0 38.0 2.0 39.0 61 30.2675 35.0 29.0 38.0 2.0 39.0 62 30.2925 35.0 29.0 38.0 2.0 39.0 63 29.70975 35.0 29.0 38.0 2.0 39.0 64 29.8175 35.0 29.0 38.0 2.0 39.0 65 29.2575 34.0 29.0 38.0 2.0 39.0 66 28.45875 34.0 27.0 37.0 2.0 39.0 67 28.042 33.0 27.0 37.0 2.0 39.0 68 27.7265 33.0 25.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 1.0 5 0.0 6 0.0 7 3.0 8 5.0 9 4.0 10 9.0 11 11.0 12 9.0 13 13.0 14 12.0 15 13.0 16 14.0 17 16.0 18 20.0 19 19.0 20 22.0 21 35.0 22 33.0 23 35.0 24 45.0 25 49.0 26 42.0 27 72.0 28 60.0 29 87.0 30 99.0 31 127.0 32 139.0 33 157.0 34 240.0 35 313.0 36 459.0 37 570.0 38 710.0 39 551.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.58354366481575 14.58859162039374 19.51034830893488 41.31751640585563 2 19.825 23.875 34.8 21.5 3 24.325 27.55 26.450000000000003 21.675 4 25.85 33.1 18.075 22.975 5 26.275 34.075 21.95 17.7 6 20.0 35.825 22.900000000000002 21.275 7 17.9 16.1 43.95 22.05 8 19.75 24.55 26.424999999999997 29.275000000000002 9 20.474999999999998 22.375 31.35 25.8 10 19.85 40.300000000000004 21.575 18.275 11 26.775 25.724999999999998 20.75 26.75 12 22.375 22.775000000000002 26.974999999999998 27.875 13 19.5 27.500000000000004 31.8 21.2 14 21.275 27.025 28.375 23.325000000000003 15 21.475 27.125 27.400000000000002 24.0 16 22.175 27.125 27.075 23.625 17 22.525000000000002 27.125 26.650000000000002 23.7 18 22.125 27.85 28.275 21.75 19 22.075 27.224999999999998 27.750000000000004 22.95 20 21.8 27.975 27.175 23.05 21 23.775 26.575 27.625 22.025 22 21.575 28.849999999999998 25.874999999999996 23.7 23 22.075 29.175 26.05 22.7 24 21.475 27.85 26.700000000000003 23.974999999999998 25 22.900000000000002 27.425 27.224999999999998 22.45 26 23.025000000000002 27.325 26.200000000000003 23.45 27 21.099999999999998 28.4 27.575 22.925 28 22.425 27.0 26.775 23.799999999999997 29 22.625 27.750000000000004 26.950000000000003 22.675 30 23.150000000000002 25.25 28.875 22.725 31 22.05 28.375 26.55 23.025000000000002 32 22.675 26.724999999999998 27.675 22.925 33 21.925 27.175 26.700000000000003 24.2 34 22.375 27.075 28.549999999999997 22.0 35 22.825 26.724999999999998 28.075 22.375 36 22.425 28.875 25.4 23.3 37 21.675 27.750000000000004 27.825 22.75 38 22.025 28.275 27.3 22.400000000000002 39 23.599999999999998 26.775 27.250000000000004 22.375 40 22.45 26.85 27.3 23.400000000000002 41 22.0 28.4 27.650000000000002 21.95 42 23.45 27.150000000000002 26.5 22.900000000000002 43 21.55 27.474999999999998 28.799999999999997 22.175 44 22.85 27.025 27.500000000000004 22.625 45 22.95 27.975 26.775 22.3 46 21.45 28.749999999999996 27.35 22.45 47 21.725 27.700000000000003 27.500000000000004 23.075000000000003 48 21.9 28.199999999999996 27.625 22.275 49 21.3 28.349999999999998 28.075 22.275 50 23.175 26.5 27.450000000000003 22.875 51 22.400000000000002 27.55 26.450000000000003 23.599999999999998 52 23.925 26.650000000000002 27.450000000000003 21.975 53 23.775 26.075 27.375 22.775000000000002 54 22.525000000000002 26.424999999999997 27.275 23.775 55 22.375 27.200000000000003 27.875 22.55 56 23.175 26.35 28.375 22.1 57 21.975 27.275 28.175 22.575 58 22.6 27.375 28.249999999999996 21.775 59 23.275000000000002 27.750000000000004 27.35 21.625 60 22.3 27.375 26.924999999999997 23.400000000000002 61 23.0 27.200000000000003 28.075 21.725 62 21.65 28.15 27.250000000000004 22.95 63 22.575 26.924999999999997 27.925 22.575 64 23.075000000000003 27.500000000000004 27.725 21.7 65 23.45 27.05 26.950000000000003 22.55 66 21.925 28.15 27.675 22.25 67 21.775 28.1 27.825 22.3 68 23.625 27.525 25.575 23.275000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 2.0 23 2.0 24 4.0 25 6.0 26 11.5 27 19.0 28 21.0 29 27.5 30 42.0 31 50.0 32 59.5 33 82.0 34 95.0 35 118.0 36 156.5 37 172.0 38 186.0 39 227.5 40 277.0 41 299.0 42 295.0 43 301.5 44 312.0 45 328.5 46 325.5 47 306.0 48 289.5 49 251.5 50 230.0 51 201.5 52 165.0 53 157.0 54 137.5 55 97.5 56 77.0 57 79.5 58 68.5 59 55.0 60 48.5 61 41.5 62 41.0 63 32.0 64 23.0 65 17.5 66 12.0 67 10.5 68 12.0 69 15.0 70 11.5 71 8.0 72 8.0 73 9.5 74 8.0 75 5.0 76 7.0 77 5.5 78 2.0 79 2.0 80 1.5 81 1.0 82 1.5 83 1.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.51947395042995 98.375 2 0.4046535154274153 0.8 3 0.025290844714213456 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025290844714213456 0.2 9 0.0 0.0 >10 0.025290844714213456 0.5499999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAA 22 0.5499999999999999 TruSeq Adapter, Index 4 (100% over 63bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAA 8 0.2 TruSeq Adapter, Index 4 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.25 0.0 0.0 0.0 0.0 2 0.25 0.0 0.0 0.0 0.0 3 0.25 0.0 0.0 0.0 0.0 4 0.25 0.0 0.0 0.0 0.0 5 0.25 0.0 0.0 0.0 0.0 6 0.25 0.0 0.0 0.0 0.0 7 0.25 0.0 0.0 0.0 0.0 8 0.25 0.0 0.0 0.0 0.0 9 0.25 0.0 0.0 0.0 0.0 10 0.25 0.0 0.0 0.0 0.0 11 0.25 0.0 0.0 0.0 0.0 12 0.25 0.0 0.0 0.0 0.0 13 0.25 0.0 0.0 0.0 0.0 14 0.25 0.0 0.0 0.0 0.0 15 0.25 0.0 0.0 0.0 0.0 16 0.25 0.0 0.0 0.0 0.0 17 0.25 0.0 0.0 0.0 0.0 18 0.25 0.0 0.0 0.0 0.0 19 0.25 0.0 0.0 0.0 0.0 20 0.25 0.0 0.0 0.0 0.0 21 0.25 0.0 0.0 0.0 0.0 22 0.25 0.0 0.0 0.0 0.0 23 0.25 0.0 0.0 0.0 0.0 24 0.25 0.0 0.0 0.0 0.0 25 0.25 0.0 0.0 0.0 0.0 26 0.25 0.0 0.0 0.0 0.0 27 0.25 0.0 0.0 0.0 0.0 28 0.25 0.0 0.0 0.0 0.0 29 0.25 0.0 0.0 0.0 0.0 30 0.25 0.0 0.0 0.0 0.0 31 0.275 0.0 0.0 0.0 0.0 32 0.275 0.0 0.0 0.0 0.0 33 0.275 0.0 0.0 0.0 0.0 34 0.275 0.0 0.0 0.0 0.0 35 0.275 0.0 0.0 0.0 0.0 36 0.275 0.0 0.0 0.0 0.0 37 0.275 0.0 0.0 0.0 0.0 38 0.275 0.0 0.0 0.0 0.0 39 0.275 0.0 0.0 0.0 0.0 40 0.275 0.0 0.0 0.0 0.0 41 0.275 0.0 0.0 0.0 0.0 42 0.275 0.0 0.0 0.0 0.0 43 0.275 0.0 0.0 0.0 0.0 44 0.275 0.0 0.0 0.0 0.0 45 0.275 0.0 0.0 0.0 0.0 46 0.275 0.0 0.0 0.0 0.0 47 0.275 0.0 0.0 0.0 0.0 48 0.275 0.0 0.0 0.0 0.0 49 0.275 0.0 0.0 0.0 0.0 50 0.3 0.0 0.0 0.0 0.0 51 0.3 0.0 0.0 0.0 0.0 52 0.3 0.0 0.0 0.0 0.0 53 0.3 0.0 0.0 0.0 0.0 54 0.3 0.0 0.0 0.0 0.0 55 0.3 0.0 0.0 0.0 0.0 56 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra Read 157212 spots for SRR3207748.sra Written 157212 spots for SRR3207748.sra Read 157208 spots for SRR3207748.sra Written 157208 spots for SRR3207748.sra SRR ids: ['SRR3207748.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vhm99oir SRR3207748.sra spots: 3144164 blocks: [[1, 157208], [157209, 314416], [314417, 471624], [471625, 628832], [628833, 786040], [786041, 943248], [943249, 1100456], [1100457, 1257664], [1257665, 1414872], [1414873, 1572080], [1572081, 1729288], [1729289, 1886496], [1886497, 2043704], [2043705, 2200912], [2200913, 2358120], [2358121, 2515328], [2515329, 2672536], [2672537, 2829744], [2829745, 2986952], [2986953, 3144164]] SRR3207748 file size 659688 SRR3207748 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207748 SRR3207748_1.fastq Input file: SRR3207748_1.fastq trimmed: SRR3207748-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 19:28:45 2025 >> started Mon Feb 10 19:28:47 2025 >> done (1.497s) 3144164 reads processed; of these: 5850 ( 0.19%) short reads filtered out after trimming by size control 40296 ( 1.28%) empty reads filtered out after trimming by size control 3098018 (98.53%) reads available; of these: 445361 (14.38%) trimmed reads available after processing 2652657 (85.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 933 0.03% 19 1706 0.06% 20 3219 0.10% 21 1041 0.03% 22 1489 0.05% 23 2287 0.07% 24 3919 0.13% 25 6597 0.21% 26 1748 0.06% 27 2117 0.07% 28 2807 0.09% 29 4663 0.15% 30 6714 0.22% 31 1854 0.06% 32 2682 0.09% 33 2921 0.09% 34 4708 0.15% 35 7398 0.24% 36 2250 0.07% 37 2848 0.09% 38 4383 0.14% 39 7173 0.23% 40 11361 0.37% 41 2889 0.09% 42 3834 0.12% 43 5794 0.19% 44 9580 0.31% 45 14942 0.48% 46 3779 0.12% 47 5048 0.16% 48 7463 0.24% 49 12539 0.40% 50 19408 0.63% 51 5086 0.16% 52 6495 0.21% 53 9410 0.30% 54 15537 0.50% 55 24871 0.80% 56 6244 0.20% 57 8194 0.26% 58 12302 0.40% 59 20193 0.65% 60 34230 1.10% 61 8027 0.26% 62 10737 0.35% 63 15652 0.51% 64 24996 0.81% 65 39598 1.28% 66 10236 0.33% 67 21459 0.69% 68 2652657 85.62% 3098018 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=23 prefix-density=0.17 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=14 fanout-score=83.65 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=15.2 sequence=AAGAAGAAGAAA Started job on | Feb 10 19:29:02 Started mapping on | Feb 10 19:29:02 Finished on | Feb 10 19:29:07 Mapping speed, Million of reads per hour | 2230.57 Number of input reads | 3098018 Average input read length | 65 UNIQUE READS: Uniquely mapped reads number | 2598139 Uniquely mapped reads % | 83.86% Average mapped length | 66.31 Number of splices: Total | 458273 Number of splices: Annotated (sjdb) | 448930 Number of splices: GT/AG | 450802 Number of splices: GC/AG | 6149 Number of splices: AT/AC | 489 Number of splices: Non-canonical | 833 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 111513 % of reads mapped to multiple loci | 3.60% Number of reads mapped to too many loci | 353010 % of reads mapped to too many loci | 11.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.13% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 388366 388366 388366 N_multimapping 111513 111513 111513 N_noFeature 189154 1384902 1386487 N_ambiguous 25849 4937 5047 UnstrandedReadsAssigned:2383136 PositiveStrandReadsAssigned:1208300 NegativeStrandReadsAssigned:1206605 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207748 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207748-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,098,018 reads, 2,731,467 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR3207748.ke.tsv 34699 SRR3207748.se.tsv 87100 total ==> SRR3207748.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 141 37.7106 Potri.005G024800.1.v4.1 1035 936 48 26.3199 Potri.004G059700.1.v4.1 961 862 1 0.595404 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 49.2235 8.88303 Potri.016G087400.1.v4.1 270 171 56 168.078 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 7.46841 2.28977 Potri.012G127500.1.v4.1 977 878 946 552.988 ==> SRR3207748.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 283 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 35 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR3207748 completed mapping pipeline successfully