Starting /dee2/code/volunteer_pipeline.sh SRR3207749 current disk space = 3057076756480 free memory = 1334867116 SRR3207749 SRAfilesize a1eda5dd08994fbb1a38024a104bb0e0 SRR3207749.sra SRR3207749.sra file validated SRR3207749 is single end SRR3207749 is conventional basespace SRR3207749 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207749_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46475 39.0 37.0 40.0 33.0 40.0 2 36.445 39.0 36.0 40.0 31.0 40.0 3 36.4535 39.0 36.0 40.0 31.0 40.0 4 36.3745 39.0 36.0 40.0 31.0 40.0 5 36.37725 39.0 36.0 40.0 31.0 40.0 6 36.5475 39.0 36.0 40.0 31.0 40.0 7 36.6165 39.0 36.0 40.0 31.0 40.0 8 36.449 39.0 36.0 40.0 31.0 40.0 9 36.425 39.0 36.0 40.0 30.0 40.0 10 36.452 39.0 36.0 40.0 31.0 40.0 11 36.74775 39.0 36.0 40.0 31.0 40.0 12 36.70525 39.0 36.0 40.0 31.0 40.0 13 36.69425 39.0 36.0 40.0 31.0 40.0 14 36.53325 38.0 36.0 40.0 31.0 40.0 15 36.525 38.0 36.0 40.0 31.0 40.0 16 36.6065 38.0 36.0 40.0 31.0 40.0 17 36.45825 38.0 35.0 40.0 31.0 40.0 18 36.353 38.0 35.0 40.0 31.0 40.0 19 36.40325 38.0 35.0 40.0 31.0 40.0 20 36.3215 38.0 35.0 40.0 31.0 40.0 21 36.246 38.0 35.0 40.0 31.0 40.0 22 36.183 38.0 35.0 40.0 31.0 40.0 23 36.07225 38.0 35.0 40.0 31.0 40.0 24 35.86525 38.0 35.0 39.0 30.0 40.0 25 35.83975 38.0 35.0 40.0 29.0 40.0 26 35.50475 38.0 35.0 39.0 29.0 40.0 27 35.228 38.0 34.0 39.0 28.0 40.0 28 35.29075 38.0 34.0 39.0 29.0 40.0 29 35.09675 38.0 34.0 39.0 28.0 40.0 30 35.01675 38.0 33.0 39.0 27.0 40.0 31 35.15425 38.0 35.0 39.0 28.0 40.0 32 35.1375 38.0 34.0 39.0 28.0 40.0 33 35.03775 38.0 34.0 39.0 27.0 40.0 34 34.95525 38.0 34.0 39.0 27.0 40.0 35 34.9425 38.0 34.0 39.0 28.0 40.0 36 35.25825 38.0 35.0 39.0 29.0 40.0 37 34.88875 38.0 34.0 39.0 28.0 40.0 38 34.953 38.0 34.0 39.0 29.0 40.0 39 34.81625 38.0 33.0 39.0 28.0 40.0 40 34.784 38.0 34.0 39.0 28.0 40.0 41 34.29825 38.0 33.0 39.0 27.0 40.0 42 34.4495 38.0 33.0 39.0 27.0 40.0 43 34.3625 38.0 33.0 39.0 27.0 40.0 44 34.08975 37.0 33.0 39.0 26.0 40.0 45 33.922 37.0 33.0 39.0 25.0 40.0 46 33.8285 37.0 33.0 39.0 25.0 40.0 47 33.74375 37.0 33.0 39.0 25.0 40.0 48 33.37575 36.0 33.0 39.0 23.0 40.0 49 33.19125 36.0 33.0 39.0 23.0 40.0 50 33.218 36.0 33.0 39.0 23.0 40.0 51 32.643 36.0 32.0 39.0 22.0 40.0 52 32.5355 36.0 32.0 39.0 19.0 40.0 53 32.55425 36.0 32.0 39.0 20.0 40.0 54 32.046 36.0 31.0 38.0 18.0 39.0 55 32.08075 36.0 31.0 38.0 18.0 39.0 56 31.8505 36.0 31.0 38.0 16.0 39.0 57 31.6685 35.0 31.0 38.0 14.0 39.0 58 31.34425 35.0 31.0 38.0 10.0 39.0 59 31.129 35.0 31.0 38.0 7.0 39.0 60 30.6955 35.0 30.0 38.0 2.0 39.0 61 30.36425 35.0 30.0 38.0 2.0 39.0 62 30.44325 35.0 30.0 38.0 2.0 39.0 63 29.9695 34.0 29.0 38.0 2.0 39.0 64 29.94875 34.0 29.0 38.0 2.0 39.0 65 29.4505 34.0 29.0 37.0 2.0 39.0 66 28.77125 33.0 28.0 36.0 2.0 39.0 67 28.18875 33.0 27.0 36.0 2.0 39.0 68 27.71075 33.0 25.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 0.0 4 0.0 5 1.0 6 4.0 7 6.0 8 3.0 9 4.0 10 10.0 11 9.0 12 8.0 13 7.0 14 16.0 15 17.0 16 21.0 17 25.0 18 14.0 19 22.0 20 21.0 21 19.0 22 29.0 23 38.0 24 43.0 25 49.0 26 52.0 27 64.0 28 85.0 29 88.0 30 80.0 31 99.0 32 114.0 33 194.0 34 237.0 35 340.0 36 457.0 37 597.0 38 743.0 39 453.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.247144340602283 14.92731048805815 19.70404984423676 41.1214953271028 2 18.829707426856714 25.481370342585645 37.259314828707176 18.42960740185046 3 22.675 28.325 27.925 21.075 4 23.125 33.85 22.3 20.724999999999998 5 25.15 34.35 23.175 17.325 6 17.825 38.35 24.25 19.575 7 15.35 18.3 45.1 21.25 8 20.625 22.675 29.325000000000003 27.375 9 19.85 22.400000000000002 30.349999999999998 27.400000000000002 10 19.975 38.550000000000004 22.825 18.65 11 24.875 27.625 21.425 26.075 12 21.325 24.3 29.049999999999997 25.324999999999996 13 19.85 27.950000000000003 30.65 21.55 14 20.925 27.950000000000003 28.225 22.900000000000002 15 21.525 28.625 27.925 21.925 16 21.625 28.599999999999998 27.3 22.475 17 21.9 28.65 26.525 22.925 18 22.525000000000002 28.575 27.900000000000002 21.0 19 20.8 28.4 28.025 22.775000000000002 20 21.2 29.375 28.199999999999996 21.224999999999998 21 21.175 28.65 28.775000000000002 21.4 22 20.925 29.375 28.449999999999996 21.25 23 20.775 28.875 27.800000000000004 22.55 24 20.775 31.025000000000002 27.025 21.175 25 20.150000000000002 29.625 28.499999999999996 21.725 26 22.25 29.299999999999997 27.325 21.125 27 21.375 29.25 27.375 22.0 28 21.425 28.825 27.35 22.400000000000002 29 21.525 28.499999999999996 28.025 21.95 30 21.675 27.750000000000004 28.625 21.95 31 20.95 29.475 27.800000000000004 21.775 32 22.2 28.95 27.3 21.55 33 21.45 28.000000000000004 28.4 22.15 34 21.349999999999998 27.650000000000002 27.750000000000004 23.25 35 20.45 28.9 27.925 22.725 36 20.65 29.549999999999997 28.349999999999998 21.45 37 22.25 27.800000000000004 28.549999999999997 21.4 38 22.325 28.749999999999996 27.825 21.099999999999998 39 20.775 28.95 27.175 23.1 40 21.125 28.749999999999996 27.825 22.3 41 21.05 29.65 28.000000000000004 21.3 42 22.025 28.075 27.375 22.525000000000002 43 20.45 27.224999999999998 29.7 22.625 44 21.525 29.45 27.05 21.975 45 20.775 28.525 28.599999999999998 22.1 46 20.25 29.299999999999997 28.075 22.375 47 23.025000000000002 27.700000000000003 27.6 21.675 48 22.075 29.099999999999998 27.224999999999998 21.6 49 20.150000000000002 28.050000000000004 29.45 22.35 50 22.125 28.875 27.700000000000003 21.3 51 21.75 28.325 28.050000000000004 21.875 52 21.85 28.249999999999996 28.299999999999997 21.6 53 21.25 28.275 28.775000000000002 21.7 54 22.525000000000002 27.725 27.474999999999998 22.275 55 21.275 28.875 27.450000000000003 22.400000000000002 56 21.85 29.175 27.775 21.2 57 22.650000000000002 26.674999999999997 27.725 22.95 58 22.775000000000002 28.125 26.724999999999998 22.375 59 22.7 28.125 27.3 21.875 60 20.75 29.9 27.175 22.175 61 21.4 28.249999999999996 27.950000000000003 22.400000000000002 62 22.675 28.1 27.450000000000003 21.775 63 22.1 27.925 29.075 20.9 64 22.325 27.925 28.975 20.775 65 22.15 28.025 28.4 21.425 66 22.925 28.15 27.975 20.95 67 22.6 28.299999999999997 27.200000000000003 21.9 68 23.674999999999997 28.175 26.075 22.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 1.5 19 1.0 20 1.0 21 2.5 22 4.0 23 5.0 24 11.5 25 17.0 26 18.5 27 24.0 28 28.0 29 41.0 30 55.0 31 56.0 32 66.5 33 102.0 34 127.0 35 139.5 36 179.5 37 207.0 38 227.0 39 269.0 40 301.0 41 311.0 42 328.5 43 343.0 44 340.0 45 327.0 46 328.5 47 343.0 48 302.5 49 227.0 50 192.0 51 184.5 52 145.0 53 113.0 54 93.5 55 75.0 56 76.0 57 54.0 58 33.0 59 34.0 60 26.5 61 20.0 62 21.0 63 16.0 64 13.5 65 9.0 66 2.0 67 5.5 68 6.0 69 3.0 70 3.0 71 4.0 72 5.0 73 3.5 74 1.5 75 1.0 76 1.0 77 1.5 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6999999999999997 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.9248873309965 99.775 2 0.050075112669003496 0.1 3 0.0 0.0 4 0.0 0.0 5 0.025037556334501748 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAA 5 0.125 TruSeq Adapter, Index 5 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10 0.075 0.0 0.0 0.0 0.0 11 0.075 0.0 0.0 0.0 0.0 12 0.075 0.0 0.0 0.0 0.0 13 0.075 0.0 0.0 0.0 0.0 14 0.075 0.0 0.0 0.0 0.0 15 0.075 0.0 0.0 0.0 0.0 16 0.075 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.1 0.0 0.0 0.0 0.0 20 0.1 0.0 0.0 0.0 0.0 21 0.1 0.0 0.0 0.0 0.0 22 0.1 0.0 0.0 0.0 0.0 23 0.1 0.0 0.0 0.0 0.0 24 0.1 0.0 0.0 0.0 0.0 25 0.1 0.0 0.0 0.0 0.0 26 0.1 0.0 0.0 0.0 0.0 27 0.1 0.0 0.0 0.0 0.0 28 0.1 0.0 0.0 0.0 0.0 29 0.1 0.0 0.0 0.0 0.0 30 0.1 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.1 0.0 0.0 0.0 0.0 34 0.1 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 39 0.1 0.0 0.0 0.0 0.0 40 0.1 0.0 0.0 0.0 0.0 41 0.1 0.0 0.0 0.0 0.0 42 0.1 0.0 0.0 0.0 0.0 43 0.1 0.0 0.0 0.0 0.0 44 0.1 0.0 0.0 0.0 0.0 45 0.1 0.0 0.0 0.0 0.0 46 0.1 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.125 0.0 0.0 0.0 0.0 55 0.15 0.0 0.0 0.0 0.0 56 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579699 spots for SRR3207749.sra Written 579699 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra Read 579681 spots for SRR3207749.sra Written 579681 spots for SRR3207749.sra SRR ids: ['SRR3207749.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q0nywuq3 SRR3207749.sra spots: 11593638 blocks: [[1, 579681], [579682, 1159362], [1159363, 1739043], [1739044, 2318724], [2318725, 2898405], [2898406, 3478086], [3478087, 4057767], [4057768, 4637448], [4637449, 5217129], [5217130, 5796810], [5796811, 6376491], [6376492, 6956172], [6956173, 7535853], [7535854, 8115534], [8115535, 8695215], [8695216, 9274896], [9274897, 9854577], [9854578, 10434258], [10434259, 11013939], [11013940, 11593638]] SRR3207749 file size 2436968 SRR3207749 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207749 SRR3207749_1.fastq Input file: SRR3207749_1.fastq trimmed: SRR3207749-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 19:04:49 2025 >> started Mon Feb 10 19:04:55 2025 >> done (5.462s) 11593638 reads processed; of these: 17199 ( 0.15%) short reads filtered out after trimming by size control 48873 ( 0.42%) empty reads filtered out after trimming by size control 11527566 (99.43%) reads available; of these: 1298588 (11.27%) trimmed reads available after processing 10228978 (88.73%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2552 0.02% 19 4421 0.04% 20 7831 0.07% 21 2648 0.02% 22 3789 0.03% 23 5982 0.05% 24 10134 0.09% 25 17239 0.15% 26 4397 0.04% 27 5592 0.05% 28 7640 0.07% 29 11601 0.10% 30 17597 0.15% 31 5145 0.04% 32 6648 0.06% 33 7694 0.07% 34 12182 0.11% 35 19239 0.17% 36 6002 0.05% 37 7578 0.07% 38 11086 0.10% 39 17867 0.15% 40 29273 0.25% 41 7491 0.06% 42 10020 0.09% 43 15003 0.13% 44 24648 0.21% 45 39356 0.34% 46 10230 0.09% 47 13368 0.12% 48 19681 0.17% 49 33816 0.29% 50 53990 0.47% 51 13207 0.11% 52 18093 0.16% 53 26796 0.23% 54 43866 0.38% 55 72075 0.63% 56 17575 0.15% 57 23911 0.21% 58 36269 0.31% 59 61548 0.53% 60 106430 0.92% 61 24509 0.21% 62 32548 0.28% 63 49038 0.43% 64 81608 0.71% 65 129903 1.13% 66 34108 0.30% 67 75364 0.65% 68 10228978 88.73% 11527566 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=3.83 fanout-score-rank=19 prefix-density=0.08 prefix-fanout=3.8 sequence=CAAGGTGGGTACAACCAACAAGAGCACAGGGGCGGCGCACAAGGTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=14 fanout-score=177.86 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=21.1 sequence=TTCTTCTTCTTT Started job on | Feb 10 19:05:10 Started mapping on | Feb 10 19:05:10 Finished on | Feb 10 19:05:22 Mapping speed, Million of reads per hour | 3458.27 Number of input reads | 11527566 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 10756172 Uniquely mapped reads % | 93.31% Average mapped length | 66.38 Number of splices: Total | 1904059 Number of splices: Annotated (sjdb) | 1863354 Number of splices: GT/AG | 1872618 Number of splices: GC/AG | 25783 Number of splices: AT/AC | 2076 Number of splices: Non-canonical | 3582 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 389837 % of reads mapped to multiple loci | 3.38% Number of reads mapped to too many loci | 288688 % of reads mapped to too many loci | 2.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.80% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 381557 381557 381557 N_multimapping 389837 389837 389837 N_noFeature 707201 5695786 5696715 N_ambiguous 113801 21337 21789 UnstrandedReadsAssigned:9935170 PositiveStrandReadsAssigned:5039049 NegativeStrandReadsAssigned:5037668 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207749 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207749-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,527,566 reads, 10,357,014 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR3207749.ke.tsv 34699 SRR3207749.se.tsv 87100 total ==> SRR3207749.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 801 59.278 Potri.005G024800.1.v4.1 1035 936 359 54.4697 Potri.004G059700.1.v4.1 961 862 2 0.329503 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 188.244 9.40002 Potri.016G087400.1.v4.1 270 171 190 157.795 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 45.6225 3.87044 Potri.012G127500.1.v4.1 977 878 2303 372.508 ==> SRR3207749.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1631 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 183 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 21 SRR3207749 completed mapping pipeline successfully