Starting /dee2/code/volunteer_pipeline.sh SRR3207750 current disk space = 3056642969600 free memory = 1472444752 SRR3207750 SRAfilesize c540ac34266d6f08f1fd74ba5a02783c SRR3207750.sra SRR3207750.sra file validated SRR3207750 is single end SRR3207750 is conventional basespace SRR3207750 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207750_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.10675 39.0 37.0 40.0 33.0 40.0 2 36.2405 39.0 36.0 40.0 30.0 40.0 3 36.1605 39.0 36.0 40.0 30.0 40.0 4 36.18925 39.0 36.0 40.0 30.0 40.0 5 36.1915 39.0 36.0 40.0 30.0 40.0 6 36.41525 39.0 36.0 40.0 30.0 40.0 7 36.43625 39.0 36.0 40.0 31.0 40.0 8 36.30175 39.0 36.0 40.0 30.0 40.0 9 36.3235 39.0 36.0 40.0 30.0 40.0 10 36.346 39.0 36.0 40.0 30.0 40.0 11 36.84125 39.0 36.0 40.0 31.0 40.0 12 36.78125 39.0 36.0 40.0 31.0 40.0 13 36.75425 38.0 36.0 40.0 31.0 40.0 14 36.59275 38.0 35.0 40.0 31.0 40.0 15 36.61675 38.0 35.0 40.0 31.0 40.0 16 36.6465 38.0 36.0 40.0 31.0 40.0 17 36.3785 38.0 35.0 40.0 31.0 40.0 18 36.38075 38.0 35.0 40.0 31.0 40.0 19 36.4415 38.0 35.0 40.0 31.0 40.0 20 36.343 38.0 35.0 40.0 31.0 40.0 21 36.25125 38.0 35.0 40.0 31.0 40.0 22 36.05025 38.0 35.0 40.0 30.0 40.0 23 35.95175 38.0 35.0 40.0 30.0 40.0 24 35.78725 38.0 35.0 39.0 29.0 40.0 25 35.60175 38.0 34.0 39.0 29.0 40.0 26 35.46075 38.0 35.0 39.0 29.0 40.0 27 35.29575 38.0 34.0 39.0 29.0 40.0 28 35.2255 38.0 34.0 39.0 29.0 40.0 29 35.061 38.0 33.0 39.0 28.0 40.0 30 35.07025 38.0 33.0 39.0 28.0 40.0 31 35.103 38.0 34.0 39.0 28.0 40.0 32 34.98125 38.0 33.0 39.0 27.0 40.0 33 35.025 38.0 34.0 39.0 27.0 40.0 34 35.0285 38.0 33.0 39.0 28.0 40.0 35 34.83875 38.0 33.0 39.0 27.0 40.0 36 35.1315 38.0 34.0 39.0 28.0 40.0 37 34.9095 38.0 33.0 39.0 28.0 40.0 38 34.8555 38.0 33.0 39.0 27.0 40.0 39 34.706 38.0 33.0 39.0 27.0 40.0 40 34.62525 38.0 33.0 39.0 27.0 40.0 41 34.3015 37.0 33.0 39.0 26.0 40.0 42 34.44125 38.0 33.0 39.0 27.0 40.0 43 34.27325 37.0 33.0 39.0 27.0 40.0 44 34.017 37.0 33.0 39.0 26.0 40.0 45 33.857 37.0 33.0 39.0 25.0 40.0 46 33.64375 37.0 33.0 39.0 25.0 40.0 47 33.405 36.0 32.0 39.0 24.0 40.0 48 33.11725 36.0 32.0 39.0 23.0 40.0 49 32.9 36.0 32.0 39.0 23.0 40.0 50 32.8345 36.0 31.0 39.0 23.0 40.0 51 32.3455 36.0 31.0 39.0 21.0 39.0 52 32.32725 36.0 31.0 39.0 21.0 39.0 53 32.27875 36.0 31.0 39.0 21.0 40.0 54 31.69275 35.0 31.0 38.0 17.0 39.0 55 31.69625 35.0 31.0 38.0 18.0 39.0 56 31.52125 35.0 31.0 38.0 13.0 39.0 57 31.325 35.0 31.0 38.0 11.0 39.0 58 30.97325 35.0 30.0 38.0 9.0 39.0 59 30.78225 35.0 30.0 38.0 2.0 39.0 60 30.4555 35.0 30.0 38.0 2.0 39.0 61 30.07525 34.0 30.0 37.0 2.0 39.0 62 30.165 35.0 30.0 38.0 2.0 39.0 63 29.57975 34.0 29.0 37.0 2.0 39.0 64 29.5875 34.0 29.0 37.0 2.0 39.0 65 29.23475 34.0 29.0 37.0 2.0 39.0 66 28.30825 33.0 27.0 36.0 2.0 39.0 67 27.761 33.0 26.0 36.0 2.0 38.0 68 27.51025 33.0 25.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 0.0 4 1.0 5 2.0 6 1.0 7 3.0 8 7.0 9 4.0 10 3.0 11 5.0 12 20.0 13 11.0 14 10.0 15 15.0 16 15.0 17 21.0 18 17.0 19 27.0 20 27.0 21 28.0 22 29.0 23 40.0 24 48.0 25 63.0 26 60.0 27 76.0 28 98.0 29 90.0 30 85.0 31 100.0 32 132.0 33 180.0 34 234.0 35 326.0 36 473.0 37 635.0 38 715.0 39 377.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.138837759663424 15.145937417828032 19.5109124375493 41.20431238495924 2 19.950000000000003 25.3 36.425000000000004 18.325 3 23.5 28.825 25.650000000000002 22.025 4 24.775 35.0 20.175 20.05 5 23.599999999999998 35.15 23.95 17.299999999999997 6 18.15 38.4 24.3 19.15 7 15.7 16.725 45.550000000000004 22.025 8 19.325 22.125 29.4 29.15 9 21.625 22.025 30.875000000000004 25.474999999999998 10 19.2 38.9 24.75 17.150000000000002 11 25.0 28.275 21.0 25.724999999999998 12 20.775 24.275 28.775000000000002 26.174999999999997 13 19.175 28.050000000000004 31.075000000000003 21.7 14 20.349999999999998 27.85 29.15 22.650000000000002 15 21.275 29.025000000000002 27.025 22.675 16 22.85 28.000000000000004 26.85 22.3 17 21.6 30.45 27.025 20.925 18 20.325 28.875 28.299999999999997 22.5 19 21.8 28.849999999999998 27.0 22.35 20 21.349999999999998 29.475 26.525 22.650000000000002 21 20.4 30.125 27.650000000000002 21.825 22 22.225 27.925 28.249999999999996 21.6 23 21.675 30.25 27.175 20.9 24 21.5 28.249999999999996 27.750000000000004 22.5 25 21.7 28.875 27.800000000000004 21.625 26 21.475 28.775000000000002 28.4 21.349999999999998 27 21.05 29.849999999999998 27.35 21.75 28 22.05 28.275 28.125 21.55 29 21.475 28.575 28.675 21.275 30 22.875 28.375 27.224999999999998 21.525 31 22.225 29.225 27.55 21.0 32 21.45 28.599999999999998 29.45 20.5 33 20.825 27.975 29.125 22.075 34 22.475 27.875 27.35 22.3 35 21.55 29.325000000000003 28.050000000000004 21.075 36 20.9 28.125 28.075 22.900000000000002 37 21.9 28.225 27.875 22.0 38 22.2 28.199999999999996 28.075 21.525 39 21.625 29.175 27.85 21.349999999999998 40 21.4 27.200000000000003 29.599999999999998 21.8 41 21.625 28.199999999999996 28.249999999999996 21.925 42 21.775 28.225 28.375 21.625 43 23.1 28.525 27.675 20.7 44 22.175 27.6 29.5 20.724999999999998 45 22.1 29.475 27.875 20.549999999999997 46 22.925 27.474999999999998 28.499999999999996 21.099999999999998 47 21.575 28.625 27.800000000000004 22.0 48 21.725 28.449999999999996 28.225 21.6 49 22.400000000000002 28.125 28.075 21.4 50 21.7 29.075 26.974999999999998 22.25 51 21.125 29.25 28.575 21.05 52 22.175 27.275 28.7 21.85 53 22.525000000000002 29.375 26.575 21.525 54 21.75 27.85 27.825 22.575 55 21.575 29.825000000000003 28.225 20.375 56 22.55 28.999999999999996 27.750000000000004 20.7 57 21.675 28.15 27.85 22.325 58 22.05 28.599999999999998 28.050000000000004 21.3 59 22.95 27.700000000000003 27.450000000000003 21.9 60 21.875 28.65 27.35 22.125 61 21.5 28.425 28.549999999999997 21.525 62 22.075 29.325000000000003 27.825 20.775 63 22.375 29.325000000000003 27.200000000000003 21.099999999999998 64 20.45 28.575 29.075 21.9 65 23.1 28.499999999999996 27.650000000000002 20.75 66 22.2 28.675 27.224999999999998 21.9 67 22.2 28.025 28.299999999999997 21.475 68 22.6 26.474999999999998 28.775000000000002 22.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 3.0 20 4.0 21 6.0 22 7.0 23 7.0 24 11.5 25 16.0 26 14.5 27 19.5 28 26.0 29 33.5 30 42.5 31 44.0 32 56.0 33 94.5 34 121.0 35 145.0 36 190.0 37 211.0 38 220.0 39 268.5 40 324.5 41 341.0 42 334.0 43 345.5 44 364.0 45 346.5 46 319.0 47 309.0 48 283.5 49 241.5 50 225.0 51 204.0 52 154.5 53 126.0 54 106.5 55 72.0 56 57.0 57 47.0 58 32.5 59 28.0 60 21.0 61 12.5 62 11.0 63 9.5 64 6.5 65 5.5 66 6.0 67 6.5 68 5.0 69 3.0 70 2.5 71 1.0 72 0.0 73 0.5 74 1.5 75 2.0 76 1.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774229 spots for SRR3207750.sra Written 774229 spots for SRR3207750.sra Read 774243 spots for SRR3207750.sra Written 774243 spots for SRR3207750.sra SRR ids: ['SRR3207750.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ii11_yln SRR3207750.sra spots: 15484594 blocks: [[1, 774229], [774230, 1548458], [1548459, 2322687], [2322688, 3096916], [3096917, 3871145], [3871146, 4645374], [4645375, 5419603], [5419604, 6193832], [6193833, 6968061], [6968062, 7742290], [7742291, 8516519], [8516520, 9290748], [9290749, 10064977], [10064978, 10839206], [10839207, 11613435], [11613436, 12387664], [12387665, 13161893], [13161894, 13936122], [13936123, 14710351], [14710352, 15484594]] SRR3207750 file size 3258493 SRR3207750 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207750 SRR3207750_1.fastq Input file: SRR3207750_1.fastq trimmed: SRR3207750-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 19:35:32 2025 >> started Mon Feb 10 19:35:39 2025 >> done (6.708s) 15484594 reads processed; of these: 22115 ( 0.14%) short reads filtered out after trimming by size control 11600 ( 0.07%) empty reads filtered out after trimming by size control 15450879 (99.78%) reads available; of these: 1733267 (11.22%) trimmed reads available after processing 13717612 (88.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3262 0.02% 19 5801 0.04% 20 9977 0.06% 21 3256 0.02% 22 4770 0.03% 23 7486 0.05% 24 13033 0.08% 25 21774 0.14% 26 5660 0.04% 27 7088 0.05% 28 9819 0.06% 29 15296 0.10% 30 23004 0.15% 31 6664 0.04% 32 8484 0.05% 33 10034 0.06% 34 15772 0.10% 35 24901 0.16% 36 7750 0.05% 37 9960 0.06% 38 14482 0.09% 39 23267 0.15% 40 37719 0.24% 41 9802 0.06% 42 13062 0.08% 43 19637 0.13% 44 32695 0.21% 45 51539 0.33% 46 13500 0.09% 47 17958 0.12% 48 26138 0.17% 49 44943 0.29% 50 72105 0.47% 51 17771 0.12% 52 23882 0.15% 53 36209 0.23% 54 58230 0.38% 55 96550 0.62% 56 24000 0.16% 57 32933 0.21% 58 48708 0.32% 59 83420 0.54% 60 142099 0.92% 61 33109 0.21% 62 44732 0.29% 63 66800 0.43% 64 109814 0.71% 65 175426 1.14% 66 46738 0.30% 67 102208 0.66% 68 13717612 88.78% 15450879 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=103.75 fanout-score-rank=4 prefix-density=0.22 prefix-fanout=15.7 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=10 fanout-score=176.00 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=20.5 sequence=TTCTTCTTCTTC Started job on | Feb 10 19:35:51 Started mapping on | Feb 10 19:35:51 Finished on | Feb 10 19:36:06 Mapping speed, Million of reads per hour | 3708.21 Number of input reads | 15450879 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 14556344 Uniquely mapped reads % | 94.21% Average mapped length | 66.38 Number of splices: Total | 2708937 Number of splices: Annotated (sjdb) | 2664840 Number of splices: GT/AG | 2669136 Number of splices: GC/AG | 32689 Number of splices: AT/AC | 3023 Number of splices: Non-canonical | 4089 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 499535 % of reads mapped to multiple loci | 3.23% Number of reads mapped to too many loci | 319795 % of reads mapped to too many loci | 2.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 395000 395000 395000 N_multimapping 499535 499535 499535 N_noFeature 755107 7598466 7612625 N_ambiguous 147215 23326 23668 UnstrandedReadsAssigned:13654022 PositiveStrandReadsAssigned:6934552 NegativeStrandReadsAssigned:6920051 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207750 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207750-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,450,879 reads, 14,180,707 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR3207750.ke.tsv 34699 SRR3207750.se.tsv 87100 total ==> SRR3207750.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 545 30.1171 Potri.005G024800.1.v4.1 1035 936 71 8.04405 Potri.004G059700.1.v4.1 961 862 17 2.09138 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 266.103 9.9223 Potri.016G087400.1.v4.1 270 171 493 305.734 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 45.5285 2.88416 Potri.012G127500.1.v4.1 977 878 1663 200.858 ==> SRR3207750.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1740 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 229 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 29 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207750 completed mapping pipeline successfully