Starting /dee2/code/volunteer_pipeline.sh SRR3207751 current disk space = 3056362450944 free memory = 1578337544 SRR3207751 SRAfilesize fca9d49305260422a7757e608b5779da SRR3207751.sra SRR3207751.sra file validated SRR3207751 is single end SRR3207751 is conventional basespace SRR3207751 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207751_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.52425 39.0 38.0 40.0 33.0 40.0 2 37.27475 39.0 38.0 40.0 33.0 40.0 3 37.21 39.0 37.0 40.0 33.0 40.0 4 37.33075 39.0 38.0 40.0 33.0 40.0 5 37.26225 39.0 38.0 40.0 33.0 40.0 6 37.2935 39.0 38.0 40.0 33.0 40.0 7 37.341 39.0 38.0 40.0 33.0 40.0 8 37.16675 39.0 37.0 40.0 33.0 40.0 9 37.14925 39.0 37.0 40.0 33.0 40.0 10 37.17175 39.0 37.0 40.0 33.0 40.0 11 37.24875 39.0 37.0 40.0 33.0 40.0 12 37.2595 39.0 37.0 40.0 32.0 40.0 13 37.24125 39.0 36.0 40.0 33.0 40.0 14 37.15975 39.0 36.0 40.0 33.0 40.0 15 37.13075 39.0 36.0 40.0 33.0 40.0 16 37.01775 39.0 36.0 40.0 32.0 40.0 17 36.94325 39.0 36.0 40.0 32.0 40.0 18 36.8805 39.0 36.0 40.0 31.0 40.0 19 36.93575 39.0 36.0 40.0 31.0 40.0 20 36.71425 39.0 36.0 40.0 31.0 40.0 21 36.72925 38.0 36.0 40.0 31.0 40.0 22 36.63975 38.0 35.0 40.0 31.0 40.0 23 36.57425 38.0 35.0 40.0 31.0 40.0 24 36.3975 38.0 35.0 40.0 31.0 40.0 25 36.3715 38.0 35.0 40.0 31.0 40.0 26 36.1405 38.0 35.0 39.0 30.0 40.0 27 35.93375 38.0 35.0 39.0 29.0 40.0 28 36.038 38.0 35.0 39.0 30.0 40.0 29 35.858 38.0 35.0 39.0 30.0 40.0 30 35.8115 38.0 35.0 39.0 29.0 40.0 31 35.917 38.0 35.0 39.0 30.0 40.0 32 35.74775 38.0 35.0 39.0 29.0 40.0 33 35.741 38.0 35.0 39.0 29.0 40.0 34 35.74875 38.0 35.0 39.0 29.0 40.0 35 35.70675 38.0 35.0 39.0 29.0 40.0 36 36.0625 38.0 35.0 40.0 30.0 40.0 37 35.73075 38.0 35.0 39.0 30.0 40.0 38 35.72775 38.0 35.0 39.0 30.0 40.0 39 35.6175 38.0 35.0 39.0 29.0 40.0 40 35.5475 38.0 35.0 39.0 29.0 40.0 41 35.1345 38.0 34.0 39.0 28.0 40.0 42 35.18875 38.0 34.0 39.0 29.0 40.0 43 35.1145 38.0 34.0 39.0 29.0 40.0 44 34.82975 38.0 33.0 39.0 27.0 40.0 45 34.8235 38.0 34.0 39.0 28.0 40.0 46 34.716 38.0 34.0 39.0 28.0 40.0 47 34.44075 37.0 33.0 39.0 27.0 40.0 48 34.22875 37.0 33.0 39.0 27.0 40.0 49 34.055 37.0 33.0 39.0 27.0 40.0 50 34.1615 37.0 33.0 39.0 26.0 40.0 51 33.58925 36.0 33.0 39.0 24.0 40.0 52 33.4475 36.0 33.0 39.0 24.0 40.0 53 33.3965 36.0 33.0 39.0 24.0 40.0 54 32.916 36.0 32.0 39.0 23.0 39.0 55 32.862 36.0 32.0 39.0 23.0 39.0 56 32.79225 36.0 32.0 39.0 23.0 39.0 57 32.6035 36.0 32.0 39.0 23.0 39.0 58 32.278 36.0 31.0 39.0 20.0 39.0 59 31.935 36.0 31.0 38.0 18.0 39.0 60 31.7545 35.0 31.0 38.0 18.0 39.0 61 31.32775 35.0 31.0 38.0 9.0 39.0 62 31.215 35.0 31.0 38.0 7.0 39.0 63 30.8515 35.0 30.0 38.0 2.0 39.0 64 30.8055 35.0 31.0 38.0 2.0 39.0 65 30.3625 34.0 30.0 38.0 2.0 39.0 66 29.6545 34.0 29.0 37.0 2.0 39.0 67 29.0635 33.0 28.0 36.0 2.0 39.0 68 28.898 33.0 27.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 2.0 5 0.0 6 1.0 7 4.0 8 2.0 9 2.0 10 5.0 11 4.0 12 12.0 13 3.0 14 4.0 15 9.0 16 12.0 17 13.0 18 14.0 19 22.0 20 16.0 21 22.0 22 35.0 23 32.0 24 33.0 25 34.0 26 54.0 27 59.0 28 62.0 29 81.0 30 86.0 31 98.0 32 140.0 33 174.0 34 221.0 35 290.0 36 451.0 37 685.0 38 800.0 39 510.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.120475828904077 15.16071880536573 18.197924576056696 42.5208807896735 2 19.379844961240313 25.35633908477119 36.23405851462866 19.02975743935984 3 22.55 29.049999999999997 26.125 22.275 4 23.974999999999998 33.800000000000004 20.5 21.725 5 25.275 36.125 21.3 17.299999999999997 6 17.625 37.675 24.65 20.05 7 15.425 17.4 46.075 21.099999999999998 8 20.025000000000002 23.075000000000003 27.500000000000004 29.4 9 19.454863715928983 24.33108277069267 31.45786446611653 24.756189047261813 10 20.9 38.1 22.8 18.2 11 24.65 26.825 22.05 26.474999999999998 12 20.674999999999997 24.375 29.225 25.724999999999998 13 19.425 27.474999999999998 31.724999999999998 21.375 14 21.175 27.450000000000003 29.825000000000003 21.55 15 21.475 28.499999999999996 28.875 21.15 16 22.7 26.275 28.075 22.95 17 22.2 28.499999999999996 27.224999999999998 22.075 18 21.85 27.85 28.375 21.925 19 21.65 27.875 27.925 22.55 20 21.875 28.575 27.975 21.575 21 20.4 29.525000000000002 28.749999999999996 21.325 22 21.45 28.749999999999996 27.650000000000002 22.15 23 22.3 30.349999999999998 26.625 20.724999999999998 24 21.725 28.000000000000004 27.750000000000004 22.525000000000002 25 21.25 29.7 28.525 20.525 26 22.05 30.125 25.95 21.875 27 21.575 29.7 26.924999999999997 21.8 28 22.25 28.225 27.725 21.8 29 22.1 27.1 28.749999999999996 22.05 30 21.75 27.1 28.849999999999998 22.3 31 21.425 28.599999999999998 26.900000000000002 23.075000000000003 32 22.6 28.999999999999996 27.224999999999998 21.175 33 21.45 28.375 28.050000000000004 22.125 34 21.375 28.475 28.625 21.525 35 22.45 28.625 27.175 21.75 36 21.9 28.050000000000004 27.625 22.425 37 21.85546386596649 29.057264316079017 27.056764191047762 22.030507626906726 38 21.825 28.050000000000004 28.225 21.9 39 22.0 28.449999999999996 27.85 21.7 40 21.099999999999998 28.749999999999996 27.425 22.725 41 22.425 28.599999999999998 28.275 20.7 42 21.85 29.825000000000003 27.075 21.25 43 21.930482620655166 28.157039259814955 27.431857964491122 22.48062015503876 44 22.2 27.925 27.474999999999998 22.400000000000002 45 21.475 28.7 27.625 22.2 46 21.925 27.474999999999998 29.099999999999998 21.5 47 22.2 28.225 27.725 21.85 48 21.625 28.725 28.65 21.0 49 21.45 29.849999999999998 26.8 21.9 50 21.625 28.275 27.925 22.175 51 22.075 27.85 28.199999999999996 21.875 52 23.075000000000003 27.725 26.85 22.35 53 21.925 27.150000000000002 28.075 22.85 54 22.475 28.825 26.924999999999997 21.775 55 20.724999999999998 28.599999999999998 28.825 21.85 56 21.275 29.4 27.525 21.8 57 22.175 27.450000000000003 28.499999999999996 21.875 58 21.55 28.499999999999996 27.775 22.175 59 21.825 28.675 27.925 21.575 60 20.875 28.425 29.099999999999998 21.6 61 21.9 27.474999999999998 28.65 21.975 62 22.075 27.675 29.325000000000003 20.925 63 22.400000000000002 27.05 28.299999999999997 22.25 64 21.55 29.049999999999997 27.775 21.625 65 22.325 27.925 27.950000000000003 21.8 66 22.85 28.65 26.8 21.7 67 21.9 28.050000000000004 27.200000000000003 22.85 68 23.25 26.724999999999998 28.999999999999996 21.025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 3.0 20 2.5 21 3.5 22 5.0 23 5.0 24 5.0 25 5.0 26 15.0 27 27.5 28 30.0 29 32.0 30 38.0 31 42.0 32 63.0 33 94.0 34 104.0 35 132.5 36 180.5 37 200.0 38 213.5 39 265.5 40 320.5 41 337.0 42 348.5 43 342.5 44 325.0 45 337.5 46 313.5 47 277.0 48 272.0 49 243.5 50 220.0 51 188.0 52 147.5 53 139.0 54 125.5 55 89.0 56 66.0 57 53.0 58 39.0 59 38.0 60 30.0 61 19.5 62 17.0 63 11.5 64 6.0 65 5.5 66 5.0 67 6.0 68 5.5 69 4.0 70 4.5 71 3.5 72 2.0 73 1.0 74 1.0 75 2.0 76 2.0 77 1.5 78 1.0 79 0.5 80 1.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.025 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.025 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182192 spots for SRR3207751.sra Written 182192 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra Read 182183 spots for SRR3207751.sra Written 182183 spots for SRR3207751.sra SRR ids: ['SRR3207751.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_almmfhnx SRR3207751.sra spots: 3643669 blocks: [[1, 182183], [182184, 364366], [364367, 546549], [546550, 728732], [728733, 910915], [910916, 1093098], [1093099, 1275281], [1275282, 1457464], [1457465, 1639647], [1639648, 1821830], [1821831, 2004013], [2004014, 2186196], [2186197, 2368379], [2368380, 2550562], [2550563, 2732745], [2732746, 2914928], [2914929, 3097111], [3097112, 3279294], [3279295, 3461477], [3461478, 3643669]] SRR3207751 file size 764651 SRR3207751 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207751 SRR3207751_1.fastq Input file: SRR3207751_1.fastq trimmed: SRR3207751-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 19:53:52 2025 >> started Mon Feb 10 19:53:56 2025 >> done (4.460s) 3643669 reads processed; of these: 5140 ( 0.14%) short reads filtered out after trimming by size control 4939 ( 0.14%) empty reads filtered out after trimming by size control 3633590 (99.72%) reads available; of these: 400303 (11.02%) trimmed reads available after processing 3233287 (88.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 719 0.02% 19 1362 0.04% 20 2285 0.06% 21 804 0.02% 22 1120 0.03% 23 1774 0.05% 24 3050 0.08% 25 5084 0.14% 26 1338 0.04% 27 1602 0.04% 28 2290 0.06% 29 3517 0.10% 30 5372 0.15% 31 1520 0.04% 32 2008 0.06% 33 2362 0.07% 34 3659 0.10% 35 5760 0.16% 36 1740 0.05% 37 2192 0.06% 38 3283 0.09% 39 5211 0.14% 40 8789 0.24% 41 2223 0.06% 42 3006 0.08% 43 4513 0.12% 44 7582 0.21% 45 12144 0.33% 46 3172 0.09% 47 4231 0.12% 48 5949 0.16% 49 10574 0.29% 50 16683 0.46% 51 4051 0.11% 52 5475 0.15% 53 8239 0.23% 54 13337 0.37% 55 22249 0.61% 56 5502 0.15% 57 7570 0.21% 58 11277 0.31% 59 19307 0.53% 60 33046 0.91% 61 7651 0.21% 62 10255 0.28% 63 15272 0.42% 64 25344 0.70% 65 40660 1.12% 66 10470 0.29% 67 23680 0.65% 68 3233287 88.98% 3633590 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=4.01 fanout-score-rank=24 prefix-density=0.04 prefix-fanout=3.7 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=19 fanout-score=194.40 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=21.0 sequence=TTCTTCTTCTTT Started job on | Feb 10 19:54:32 Started mapping on | Feb 10 19:54:33 Finished on | Feb 10 19:54:37 Mapping speed, Million of reads per hour | 3270.23 Number of input reads | 3633590 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 3425636 Uniquely mapped reads % | 94.28% Average mapped length | 66.42 Number of splices: Total | 652066 Number of splices: Annotated (sjdb) | 641716 Number of splices: GT/AG | 642518 Number of splices: GC/AG | 7895 Number of splices: AT/AC | 701 Number of splices: Non-canonical | 952 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 119908 % of reads mapped to multiple loci | 3.30% Number of reads mapped to too many loci | 69860 % of reads mapped to too many loci | 1.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 88046 88046 88046 N_multimapping 119908 119908 119908 N_noFeature 167040 1782350 1787370 N_ambiguous 34024 5530 5571 UnstrandedReadsAssigned:3224572 PositiveStrandReadsAssigned:1637756 NegativeStrandReadsAssigned:1632695 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207751 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207751-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,633,590 reads, 3,348,608 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,019 rounds 52401 SRR3207751.ke.tsv 34699 SRR3207751.se.tsv 87100 total ==> SRR3207751.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 110 25.9294 Potri.005G024800.1.v4.1 1035 936 20 9.66561 Potri.004G059700.1.v4.1 961 862 2 1.04954 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 53.751 8.54932 Potri.016G087400.1.v4.1 270 171 110 290.986 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 8 2.16177 Potri.012G127500.1.v4.1 977 878 397 204.537 ==> SRR3207751.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 408 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 45 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207751 completed mapping pipeline successfully