Starting /dee2/code/volunteer_pipeline.sh SRR3207752 current disk space = 3056250920960 free memory = 1302155352 SRR3207752 SRAfilesize c5880579224881196b18c1891e96987a SRR3207752.sra SRR3207752.sra file validated SRR3207752 is single end SRR3207752 is conventional basespace SRR3207752 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207752_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.3705 39.0 38.0 40.0 33.0 40.0 2 37.18425 39.0 37.0 40.0 33.0 40.0 3 37.1845 39.0 38.0 40.0 33.0 40.0 4 37.13125 39.0 38.0 40.0 33.0 40.0 5 37.1595 39.0 38.0 40.0 33.0 40.0 6 37.2025 39.0 37.0 40.0 33.0 40.0 7 37.234 39.0 38.0 40.0 33.0 40.0 8 37.1075 39.0 37.0 40.0 33.0 40.0 9 37.063 39.0 37.0 40.0 33.0 40.0 10 37.00175 39.0 36.0 40.0 33.0 40.0 11 37.20225 39.0 36.0 40.0 33.0 40.0 12 37.1655 39.0 36.0 40.0 32.0 40.0 13 37.0695 39.0 36.0 40.0 32.0 40.0 14 37.04025 39.0 36.0 40.0 32.0 40.0 15 36.96175 39.0 36.0 40.0 31.0 40.0 16 37.036 39.0 36.0 40.0 33.0 40.0 17 36.84 39.0 36.0 40.0 31.0 40.0 18 36.775 38.0 36.0 40.0 31.0 40.0 19 36.8125 38.0 36.0 40.0 31.0 40.0 20 36.802 39.0 36.0 40.0 31.0 40.0 21 36.66525 38.0 36.0 40.0 31.0 40.0 22 36.60925 38.0 35.0 40.0 31.0 40.0 23 36.4705 38.0 35.0 40.0 31.0 40.0 24 36.27025 38.0 35.0 40.0 30.0 40.0 25 36.2645 38.0 35.0 40.0 30.0 40.0 26 36.03125 38.0 35.0 39.0 30.0 40.0 27 35.8695 38.0 35.0 39.0 30.0 40.0 28 35.83975 38.0 35.0 39.0 29.0 40.0 29 35.70525 38.0 35.0 39.0 29.0 40.0 30 35.514 38.0 35.0 39.0 29.0 40.0 31 35.74625 38.0 35.0 39.0 29.0 40.0 32 35.53075 38.0 35.0 39.0 29.0 40.0 33 35.5315 38.0 35.0 39.0 29.0 40.0 34 35.4405 38.0 35.0 39.0 29.0 40.0 35 35.44275 38.0 34.0 39.0 29.0 40.0 36 35.82375 38.0 35.0 39.0 30.0 40.0 37 35.451 38.0 35.0 39.0 29.0 40.0 38 35.4475 38.0 35.0 39.0 29.0 40.0 39 35.41125 38.0 35.0 39.0 29.0 40.0 40 35.3255 38.0 35.0 39.0 29.0 40.0 41 35.00775 38.0 34.0 39.0 29.0 40.0 42 35.079 38.0 34.0 39.0 29.0 40.0 43 34.9185 38.0 34.0 39.0 28.0 40.0 44 34.82025 38.0 34.0 39.0 28.0 40.0 45 34.60425 38.0 33.0 39.0 28.0 40.0 46 34.49375 38.0 33.0 39.0 27.0 40.0 47 34.19775 37.0 33.0 39.0 27.0 40.0 48 33.94375 37.0 33.0 39.0 25.0 40.0 49 33.76625 36.0 33.0 39.0 25.0 40.0 50 33.8495 37.0 33.0 39.0 25.0 40.0 51 33.18575 36.0 33.0 39.0 23.0 40.0 52 33.09 36.0 32.0 39.0 23.0 40.0 53 33.05625 36.0 32.0 39.0 23.0 40.0 54 32.54475 36.0 31.0 38.0 23.0 39.0 55 32.4815 36.0 31.0 38.0 23.0 39.0 56 32.24375 36.0 32.0 38.0 20.0 39.0 57 32.05375 36.0 31.0 38.0 18.0 39.0 58 31.84325 35.0 31.0 38.0 18.0 39.0 59 31.51675 35.0 31.0 38.0 17.0 39.0 60 31.28525 35.0 31.0 38.0 16.0 39.0 61 30.85275 35.0 31.0 38.0 2.0 39.0 62 30.8395 35.0 31.0 38.0 2.0 39.0 63 30.4055 34.0 30.0 38.0 2.0 39.0 64 30.46375 34.0 30.0 38.0 2.0 39.0 65 29.8755 34.0 29.0 37.0 2.0 39.0 66 29.24225 33.0 29.0 36.0 2.0 39.0 67 28.76525 33.0 28.0 36.0 2.0 38.0 68 28.33425 33.0 27.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 0.0 4 0.0 5 3.0 6 1.0 7 2.0 8 1.0 9 6.0 10 3.0 11 8.0 12 13.0 13 10.0 14 5.0 15 11.0 16 17.0 17 8.0 18 11.0 19 13.0 20 31.0 21 24.0 22 20.0 23 25.0 24 32.0 25 53.0 26 55.0 27 49.0 28 83.0 29 68.0 30 97.0 31 115.0 32 129.0 33 164.0 34 231.0 35 344.0 36 477.0 37 662.0 38 740.0 39 475.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.776081424936386 14.249363867684478 17.709923664122137 42.264631043257 2 17.95 26.474999999999998 37.15 18.425 3 24.474999999999998 27.875 26.275 21.375 4 24.5 33.525 21.4 20.575 5 24.45 34.025 23.575 17.95 6 17.775 37.35 24.875 20.0 7 15.85 16.825000000000003 45.25 22.075 8 20.45 23.825 28.599999999999998 27.125 9 20.68017004251063 22.605651412853213 31.48287071767942 25.23130782695674 10 20.775 38.5 24.325 16.400000000000002 11 26.025 27.0 20.25 26.724999999999998 12 21.7 23.575 29.225 25.5 13 20.625 27.1 31.25 21.025 14 21.775 28.375 28.999999999999996 20.849999999999998 15 21.3 28.050000000000004 28.325 22.325 16 21.625 28.575 26.375 23.425 17 22.075 28.299999999999997 27.6 22.025 18 20.225 28.599999999999998 28.9 22.275 19 21.2 28.825 27.950000000000003 22.025 20 22.650000000000002 28.325 27.250000000000004 21.775 21 21.925 28.375 27.35 22.35 22 21.325 28.599999999999998 28.875 21.2 23 21.5 28.875 27.05 22.575 24 21.325 28.749999999999996 27.825 22.1 25 23.549999999999997 27.525 27.325 21.6 26 21.025 29.4 27.725 21.85 27 21.0 29.325000000000003 28.425 21.25 28 23.0 28.775000000000002 26.75 21.475 29 21.95 28.1 27.975 21.975 30 21.05 27.950000000000003 29.25 21.75 31 22.15 27.200000000000003 29.425 21.224999999999998 32 22.35 28.499999999999996 27.150000000000002 22.0 33 21.175 28.975 28.499999999999996 21.349999999999998 34 21.75 27.975 28.125 22.15 35 22.55 27.650000000000002 27.3 22.5 36 21.45 28.000000000000004 28.449999999999996 22.1 37 21.580395098774694 27.656914228557138 28.057014253563388 22.705676419104776 38 22.675 28.275 28.000000000000004 21.05 39 22.650000000000002 28.275 26.924999999999997 22.15 40 21.6 27.325 28.299999999999997 22.775000000000002 41 22.425 28.025 27.750000000000004 21.8 42 22.0 26.875 28.65 22.475 43 21.860930465232617 28.339169584792394 27.988994497248626 21.810905452726363 44 21.75 28.325 28.375 21.55 45 21.85 27.975 28.425 21.75 46 21.625 27.425 28.225 22.725 47 22.95 28.275 27.6 21.175 48 22.1 29.049999999999997 27.35 21.5 49 22.425 27.875 28.849999999999998 20.849999999999998 50 21.8 27.525 26.6 24.075 51 21.2 29.7 27.1 22.0 52 21.6 28.9 28.175 21.325 53 23.799999999999997 28.525 27.35 20.325 54 22.175 28.875 27.425 21.525 55 22.75 26.625 28.95 21.675 56 21.125 28.625 27.425 22.825 57 21.65 28.199999999999996 27.3 22.85 58 22.7 28.375 27.275 21.65 59 23.525 28.799999999999997 27.075 20.599999999999998 60 21.375 27.875 28.449999999999996 22.3 61 21.475 28.799999999999997 27.05 22.675 62 20.724999999999998 29.349999999999998 28.075 21.85 63 22.900000000000002 28.175 27.500000000000004 21.425 64 22.35 28.4 27.700000000000003 21.55 65 21.025 29.425 27.675 21.875 66 22.85 27.0 27.450000000000003 22.7 67 22.8 28.849999999999998 27.625 20.724999999999998 68 21.175 29.925 27.1 21.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 3.0 21 4.0 22 3.0 23 4.0 24 7.0 25 9.0 26 13.5 27 21.5 28 25.0 29 32.0 30 45.5 31 52.0 32 69.0 33 86.5 34 87.0 35 107.5 36 160.5 37 193.0 38 211.0 39 250.5 40 298.0 41 324.0 42 332.5 43 349.0 44 357.0 45 373.0 46 351.5 47 314.0 48 294.5 49 249.0 50 223.0 51 200.0 52 156.0 53 135.0 54 121.5 55 90.5 56 73.0 57 56.0 58 30.0 59 21.0 60 22.0 61 21.5 62 20.0 63 13.0 64 7.0 65 7.0 66 6.0 67 3.0 68 1.5 69 3.0 70 2.0 71 1.5 72 2.0 73 1.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.025 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.05 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.075 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258441 spots for SRR3207752.sra Written 258441 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra Read 258423 spots for SRR3207752.sra Written 258423 spots for SRR3207752.sra SRR ids: ['SRR3207752.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lstysph6 SRR3207752.sra spots: 5168478 blocks: [[1, 258423], [258424, 516846], [516847, 775269], [775270, 1033692], [1033693, 1292115], [1292116, 1550538], [1550539, 1808961], [1808962, 2067384], [2067385, 2325807], [2325808, 2584230], [2584231, 2842653], [2842654, 3101076], [3101077, 3359499], [3359500, 3617922], [3617923, 3876345], [3876346, 4134768], [4134769, 4393191], [4393192, 4651614], [4651615, 4910037], [4910038, 5168478]] SRR3207752 file size 1085122 SRR3207752 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207752 SRR3207752_1.fastq Input file: SRR3207752_1.fastq trimmed: SRR3207752-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 19:56:54 2025 >> started Mon Feb 10 19:56:56 2025 >> done (2.516s) 5168478 reads processed; of these: 7538 ( 0.15%) short reads filtered out after trimming by size control 6119 ( 0.12%) empty reads filtered out after trimming by size control 5154821 (99.74%) reads available; of these: 565971 (10.98%) trimmed reads available after processing 4588850 (89.02%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1022 0.02% 19 1847 0.04% 20 3188 0.06% 21 1035 0.02% 22 1549 0.03% 23 2414 0.05% 24 4103 0.08% 25 6931 0.13% 26 1868 0.04% 27 2362 0.05% 28 3153 0.06% 29 4806 0.09% 30 7280 0.14% 31 2180 0.04% 32 2725 0.05% 33 3253 0.06% 34 5074 0.10% 35 8155 0.16% 36 2462 0.05% 37 3131 0.06% 38 4677 0.09% 39 7433 0.14% 40 12114 0.24% 41 3122 0.06% 42 4173 0.08% 43 6343 0.12% 44 10710 0.21% 45 16732 0.32% 46 4477 0.09% 47 5923 0.11% 48 8414 0.16% 49 14656 0.28% 50 23667 0.46% 51 5835 0.11% 52 7769 0.15% 53 11907 0.23% 54 19506 0.38% 55 31110 0.60% 56 7867 0.15% 57 10583 0.21% 58 15764 0.31% 59 27196 0.53% 60 47022 0.91% 61 10680 0.21% 62 14430 0.28% 63 21672 0.42% 64 36218 0.70% 65 58372 1.13% 66 15043 0.29% 67 34018 0.66% 68 4588850 89.02% 5154821 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=5.55 fanout-score-rank=18 prefix-density=0.05 prefix-fanout=4.5 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=15 fanout-score=210.93 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=22.2 sequence=TTCTTCTTCTTC Started job on | Feb 10 19:57:11 Started mapping on | Feb 10 19:57:12 Finished on | Feb 10 19:57:17 Mapping speed, Million of reads per hour | 3711.47 Number of input reads | 5154821 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4892109 Uniquely mapped reads % | 94.90% Average mapped length | 66.40 Number of splices: Total | 932369 Number of splices: Annotated (sjdb) | 917664 Number of splices: GT/AG | 919002 Number of splices: GC/AG | 11016 Number of splices: AT/AC | 1023 Number of splices: Non-canonical | 1328 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 166704 % of reads mapped to multiple loci | 3.23% Number of reads mapped to too many loci | 71379 % of reads mapped to too many loci | 1.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.47% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 96008 96008 96008 N_multimapping 166704 166704 166704 N_noFeature 234410 2549911 2544711 N_ambiguous 47559 7628 8085 UnstrandedReadsAssigned:4610140 PositiveStrandReadsAssigned:2334570 NegativeStrandReadsAssigned:2339313 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207752 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207752-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,154,821 reads, 4,760,233 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52401 SRR3207752.ke.tsv 34699 SRR3207752.se.tsv 87100 total ==> SRR3207752.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 150 24.7772 Potri.005G024800.1.v4.1 1035 936 25 8.46642 Potri.004G059700.1.v4.1 961 862 3 1.10319 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 77.0474 8.58744 Potri.016G087400.1.v4.1 270 171 186 344.788 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 18.5845 3.51909 Potri.012G127500.1.v4.1 977 878 627 226.365 ==> SRR3207752.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 583 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 87 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207752 completed mapping pipeline successfully