Starting /dee2/code/volunteer_pipeline.sh SRR3207753 current disk space = 3056768352256 free memory = 1298993244 SRR3207753 SRAfilesize 91946aacc90b27f66732201f321a6f96 SRR3207753.sra SRR3207753.sra file validated SRR3207753 is single end SRR3207753 is conventional basespace SRR3207753 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207753_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.6845 39.0 38.0 40.0 33.0 40.0 2 37.62425 39.0 38.0 40.0 33.0 40.0 3 37.554 39.0 38.0 40.0 33.0 40.0 4 37.548 39.0 38.0 40.0 33.0 40.0 5 37.50625 39.0 38.0 40.0 33.0 40.0 6 37.622 39.0 38.0 40.0 33.0 40.0 7 37.728 39.0 38.0 40.0 33.0 40.0 8 37.703 39.0 38.0 40.0 33.0 40.0 9 37.62 39.0 38.0 40.0 33.0 40.0 10 37.5825 39.0 38.0 40.0 33.0 40.0 11 37.92125 39.0 38.0 40.0 33.0 40.0 12 37.75625 39.0 38.0 40.0 33.0 40.0 13 37.62325 39.0 38.0 40.0 33.0 40.0 14 37.65925 39.0 38.0 40.0 33.0 40.0 15 37.5875 39.0 38.0 40.0 33.0 40.0 16 37.644 39.0 38.0 40.0 33.0 40.0 17 37.47025 39.0 38.0 40.0 33.0 40.0 18 37.5205 39.0 38.0 40.0 33.0 40.0 19 37.35875 39.0 38.0 40.0 33.0 40.0 20 37.27825 39.0 37.0 40.0 32.0 40.0 21 37.31825 39.0 37.0 40.0 33.0 40.0 22 37.15175 39.0 37.0 40.0 32.0 40.0 23 37.09075 39.0 36.0 40.0 32.0 40.0 24 36.969 39.0 36.0 40.0 31.0 40.0 25 36.8695 39.0 36.0 40.0 31.0 40.0 26 36.7965 39.0 36.0 40.0 31.0 40.0 27 36.88775 39.0 36.0 40.0 31.0 40.0 28 36.77875 39.0 36.0 40.0 31.0 40.0 29 36.721 39.0 36.0 40.0 31.0 40.0 30 36.6175 39.0 36.0 40.0 31.0 40.0 31 36.4225 39.0 36.0 40.0 31.0 40.0 32 36.4515 39.0 36.0 40.0 31.0 40.0 33 36.46825 39.0 36.0 40.0 31.0 40.0 34 36.39225 39.0 36.0 40.0 31.0 40.0 35 36.29475 39.0 36.0 40.0 30.0 40.0 36 36.16 39.0 36.0 40.0 30.0 40.0 37 36.23275 39.0 36.0 40.0 30.0 40.0 38 35.98425 39.0 35.0 40.0 30.0 40.0 39 36.06775 39.0 35.0 40.0 30.0 40.0 40 35.73075 39.0 35.0 40.0 29.0 40.0 41 35.883 39.0 35.0 40.0 30.0 40.0 42 35.5935 38.0 35.0 40.0 29.0 40.0 43 35.65025 38.0 35.0 40.0 30.0 40.0 44 35.477 38.0 35.0 40.0 29.0 40.0 45 35.24475 38.0 34.0 39.0 29.0 40.0 46 35.09125 38.0 35.0 39.0 28.0 40.0 47 34.47275 38.0 33.0 39.0 26.0 40.0 48 34.745 38.0 34.0 39.0 27.0 40.0 49 34.5405 38.0 34.0 39.0 26.0 40.0 50 34.49175 38.0 33.0 39.0 27.0 40.0 51 34.33075 38.0 33.0 39.0 26.0 40.0 52 34.25325 38.0 33.0 39.0 27.0 40.0 53 33.96375 37.0 33.0 39.0 26.0 40.0 54 33.76825 37.0 33.0 39.0 25.0 40.0 55 33.616 37.0 33.0 39.0 25.0 40.0 56 33.50475 36.0 33.0 39.0 25.0 40.0 57 33.27825 36.0 33.0 39.0 23.0 40.0 58 33.037 36.0 33.0 39.0 23.0 40.0 59 32.538 36.0 32.0 38.0 22.0 39.0 60 32.534 36.0 32.0 39.0 21.0 39.0 61 32.368 36.0 32.0 39.0 17.0 39.0 62 32.08475 36.0 32.0 38.0 18.0 39.0 63 31.5625 35.0 31.0 38.0 15.0 39.0 64 31.53275 35.0 31.0 38.0 8.0 39.0 65 31.53525 36.0 31.0 38.0 2.0 39.0 66 31.0295 35.0 31.0 38.0 2.0 39.0 67 30.66575 35.0 31.0 38.0 2.0 39.0 68 30.18425 34.0 29.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 0.0 5 1.0 6 7.0 7 4.0 8 6.0 9 5.0 10 4.0 11 4.0 12 7.0 13 10.0 14 6.0 15 16.0 16 9.0 17 14.0 18 9.0 19 19.0 20 14.0 21 25.0 22 25.0 23 25.0 24 28.0 25 37.0 26 44.0 27 43.0 28 42.0 29 74.0 30 54.0 31 86.0 32 103.0 33 123.0 34 182.0 35 224.0 36 351.0 37 505.0 38 878.0 39 1005.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.249683143219265 11.761723700887199 15.817490494296576 45.171102661596954 2 23.599999999999998 20.65 31.7 24.05 3 26.625 24.349999999999998 22.7 26.325 4 27.975 29.675 17.8 24.55 5 27.575 30.75 21.5 20.175 6 21.175 34.0 22.225 22.6 7 18.9 15.950000000000001 41.0 24.15 8 21.75 19.5 27.025 31.724999999999998 9 23.875 21.825 27.800000000000004 26.5 10 22.475 35.4 20.4 21.725 11 26.05 25.424999999999997 19.075 29.45 12 23.125 21.099999999999998 27.025 28.749999999999996 13 22.725 25.674999999999997 29.125 22.475 14 23.474999999999998 25.825 26.724999999999998 23.974999999999998 15 24.55 25.324999999999996 25.025 25.1 16 24.675 25.275 25.874999999999996 24.175 17 25.35 25.3 25.900000000000002 23.45 18 23.45 26.275 26.724999999999998 23.549999999999997 19 25.374999999999996 24.3 26.224999999999998 24.099999999999998 20 24.474999999999998 24.25 26.474999999999998 24.8 21 25.025 25.924999999999997 25.174999999999997 23.875 22 24.4 26.075 25.825 23.7 23 25.0 26.525 24.85 23.625 24 24.349999999999998 25.724999999999998 25.174999999999997 24.75 25 24.256064016004 25.256314078519633 26.38159539884971 24.10602650662666 26 24.68734367183592 24.487243621810904 26.93846923461731 23.88694347173587 27 23.849999999999998 25.924999999999997 25.25 24.975 28 24.025 24.349999999999998 26.25 25.374999999999996 29 24.525 26.525 23.799999999999997 25.15 30 24.65 26.075 24.725 24.55 31 24.25 24.725 25.650000000000002 25.374999999999996 32 25.35 24.575 25.525 24.55 33 22.8 25.85 25.275 26.075 34 24.349999999999998 25.724999999999998 24.3 25.624999999999996 35 23.7 25.874999999999996 25.15 25.275 36 24.224999999999998 25.374999999999996 25.224999999999998 25.174999999999997 37 25.25 25.775 24.975 24.0 38 24.175 24.775 25.3 25.75 39 26.174999999999997 26.174999999999997 23.575 24.075 40 25.05 26.825 23.849999999999998 24.275 41 26.55 25.3 23.375 24.775 42 24.3 26.400000000000002 24.65 24.65 43 25.924999999999997 25.75 24.15 24.175 44 24.45 24.575 25.1 25.874999999999996 45 24.625 25.474999999999998 25.324999999999996 24.575 46 26.174999999999997 25.324999999999996 23.05 25.45 47 25.25 24.975 24.625 25.15 48 24.0 27.025 24.625 24.349999999999998 49 24.474999999999998 25.6 25.575 24.349999999999998 50 25.3 24.474999999999998 24.65 25.575 51 24.025 25.174999999999997 26.55 24.25 52 26.1 25.45 24.025 24.425 53 25.5 26.325 24.025 24.15 54 25.275 26.1 24.5 24.125 55 24.45 26.025 25.1 24.425 56 24.125 24.7 26.150000000000002 25.025 57 23.974999999999998 25.5 25.75 24.775 58 24.45 25.15 25.474999999999998 24.925 59 25.974999999999998 23.549999999999997 25.374999999999996 25.1 60 25.275 24.975 25.650000000000002 24.099999999999998 61 25.025 25.5 25.900000000000002 23.575 62 25.4 25.474999999999998 24.875 24.25 63 23.799999999999997 24.95 26.375 24.875 64 25.324999999999996 25.074999999999996 25.374999999999996 24.224999999999998 65 24.725 25.724999999999998 25.174999999999997 24.375 66 24.45 25.5 23.724999999999998 26.325 67 25.174999999999997 25.8 24.25 24.775 68 25.374999999999996 24.975 24.675 24.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 1.0 24 2.5 25 3.0 26 7.0 27 10.5 28 10.0 29 16.5 30 30.0 31 37.0 32 39.5 33 45.0 34 48.0 35 57.5 36 91.0 37 115.0 38 123.5 39 148.0 40 171.5 41 179.0 42 209.0 43 253.0 44 267.0 45 279.0 46 281.0 47 271.0 48 266.5 49 249.0 50 236.0 51 241.5 52 206.5 53 166.0 54 157.5 55 155.5 56 162.0 57 152.5 58 124.0 59 105.0 60 102.0 61 96.5 62 94.0 63 71.5 64 52.5 65 50.5 66 45.0 67 46.0 68 45.5 69 44.0 70 40.5 71 33.5 72 30.0 73 37.5 74 33.5 75 22.0 76 25.0 77 22.0 78 16.0 79 12.0 80 5.0 81 2.0 82 2.5 83 2.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.025 26 0.05 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.525 #Duplication Level Percentage of deduplicated Percentage of total 1 91.62245182909801 82.025 2 6.115610164758448 10.95 3 1.6475844736107235 4.425 4 0.3909522479754258 1.4000000000000001 5 0.13962580284836637 0.625 6 0.027925160569673275 0.15 7 0.027925160569673275 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.027925160569673275 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGAAAAA 10 0.25 TruSeq Adapter, Index 2 (100% over 63bp) CTTGTCCGTACCAGTTCTGAGTCGACTGTTCGACGCCCGGGGAAGGCCCCCGAAGGGGCCGTTCCCAG 7 0.17500000000000002 No Hit CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTAGAGGCGTTCAGTCATA 6 0.15 No Hit CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGT 5 0.125 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 5 0.125 No Hit CAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGGGAAAGGTTCCATGTGAACGGCACTTGCACAT 5 0.125 No Hit CCCGGATCGGCCGCCGAAGCGGCCTTGGGTCCAAAAAGAGGGGCAGCGCCCCGCCTCCGATTCACGGA 5 0.125 No Hit CCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.125 0.0 0.0 0.0 0.0 2 0.125 0.0 0.0 0.0 0.0 3 0.125 0.0 0.0 0.0 0.0 4 0.125 0.0 0.0 0.0 0.0 5 0.125 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10 0.125 0.0 0.0 0.0 0.0 11 0.125 0.0 0.0 0.0 0.0 12 0.125 0.0 0.0 0.0 0.0 13 0.125 0.0 0.0 0.0 0.0 14 0.125 0.0 0.0 0.0 0.0 15 0.125 0.0 0.0 0.0 0.0 16 0.125 0.0 0.0 0.0 0.0 17 0.125 0.0 0.0 0.0 0.0 18 0.125 0.0 0.0 0.0 0.0 19 0.125 0.0 0.0 0.0 0.0 20 0.125 0.0 0.0 0.0 0.0 21 0.125 0.0 0.0 0.0 0.0 22 0.125 0.0 0.0 0.0 0.0 23 0.125 0.0 0.0 0.0 0.0 24 0.125 0.0 0.0 0.0 0.0 25 0.125 0.0 0.0 0.0 0.0 26 0.125 0.0 0.0 0.0 0.0 27 0.125 0.0 0.0 0.0 0.0 28 0.125 0.0 0.0 0.0 0.0 29 0.125 0.0 0.0 0.0 0.0 30 0.125 0.0 0.0 0.0 0.0 31 0.125 0.0 0.0 0.0 0.0 32 0.125 0.0 0.0 0.0 0.0 33 0.125 0.0 0.0 0.0 0.0 34 0.125 0.0 0.0 0.0 0.0 35 0.125 0.0 0.0 0.0 0.0 36 0.125 0.0 0.0 0.0 0.0 37 0.125 0.0 0.0 0.0 0.0 38 0.125 0.0 0.0 0.0 0.0 39 0.125 0.0 0.0 0.0 0.0 40 0.125 0.0 0.0 0.0 0.0 41 0.125 0.0 0.0 0.0 0.0 42 0.125 0.0 0.0 0.0 0.0 43 0.125 0.0 0.0 0.0 0.0 44 0.125 0.0 0.0 0.0 0.0 45 0.125 0.0 0.0 0.0 0.0 46 0.125 0.0 0.0 0.0 0.0 47 0.125 0.0 0.0 0.0 0.0 48 0.125 0.0 0.0 0.0 0.0 49 0.125 0.0 0.0 0.0 0.0 50 0.125 0.0 0.0 0.0 0.0 51 0.125 0.0 0.0 0.0 0.0 52 0.125 0.0 0.0 0.0 0.0 53 0.125 0.0 0.0 0.0 0.0 54 0.125 0.0 0.0 0.0 0.0 55 0.125 0.0 0.0 0.0 0.0 56 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104821 spots for SRR3207753.sra Written 104821 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra Read 104816 spots for SRR3207753.sra Written 104816 spots for SRR3207753.sra SRR ids: ['SRR3207753.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9j0bm119 SRR3207753.sra spots: 2096325 blocks: [[1, 104816], [104817, 209632], [209633, 314448], [314449, 419264], [419265, 524080], [524081, 628896], [628897, 733712], [733713, 838528], [838529, 943344], [943345, 1048160], [1048161, 1152976], [1152977, 1257792], [1257793, 1362608], [1362609, 1467424], [1467425, 1572240], [1572241, 1677056], [1677057, 1781872], [1781873, 1886688], [1886689, 1991504], [1991505, 2096325]] SRR3207753 file size 436737 SRR3207753 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207753 SRR3207753_1.fastq Input file: SRR3207753_1.fastq trimmed: SRR3207753-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 19:26:08 2025 >> started Mon Feb 10 19:26:09 2025 >> done (1.120s) 2096325 reads processed; of these: 7076 ( 0.34%) short reads filtered out after trimming by size control 18248 ( 0.87%) empty reads filtered out after trimming by size control 2071001 (98.79%) reads available; of these: 198437 ( 9.58%) trimmed reads available after processing 1872564 (90.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 674 0.03% 19 1098 0.05% 20 1842 0.09% 21 558 0.03% 22 784 0.04% 23 1108 0.05% 24 1674 0.08% 25 2995 0.14% 26 858 0.04% 27 960 0.05% 28 1260 0.06% 29 2025 0.10% 30 3317 0.16% 31 983 0.05% 32 1181 0.06% 33 1315 0.06% 34 2158 0.10% 35 3289 0.16% 36 1014 0.05% 37 1347 0.07% 38 1963 0.09% 39 3003 0.15% 40 5174 0.25% 41 1386 0.07% 42 1710 0.08% 43 2534 0.12% 44 4044 0.20% 45 7333 0.35% 46 1685 0.08% 47 2066 0.10% 48 3182 0.15% 49 4903 0.24% 50 8106 0.39% 51 2139 0.10% 52 2731 0.13% 53 3825 0.18% 54 6353 0.31% 55 11100 0.54% 56 2900 0.14% 57 3598 0.17% 58 5369 0.26% 59 8637 0.42% 60 17437 0.84% 61 3501 0.17% 62 4543 0.22% 63 6721 0.32% 64 10883 0.53% 65 18874 0.91% 66 3848 0.19% 67 8449 0.41% 68 1872564 90.42% 2071001 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=23 prefix-density=0.68 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=17.24 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=1.0 sequence=GTCTCTCGCCCATATTTAGCCTT Started job on | Feb 10 19:26:26 Started mapping on | Feb 10 19:26:26 Finished on | Feb 10 19:26:38 Mapping speed, Million of reads per hour | 621.30 Number of input reads | 2071001 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 873154 Uniquely mapped reads % | 42.16% Average mapped length | 67.04 Number of splices: Total | 153230 Number of splices: Annotated (sjdb) | 150446 Number of splices: GT/AG | 150972 Number of splices: GC/AG | 1841 Number of splices: AT/AC | 145 Number of splices: Non-canonical | 272 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.01% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 55168 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 1116551 % of reads mapped to too many loci | 53.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.25% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1142679 1142679 1142679 N_multimapping 55168 55168 55168 N_noFeature 67403 465871 468173 N_ambiguous 9414 1436 1480 UnstrandedReadsAssigned:796337 PositiveStrandReadsAssigned:405847 NegativeStrandReadsAssigned:403501 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207753 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207753-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,071,001 reads, 1,783,994 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR3207753.ke.tsv 34699 SRR3207753.se.tsv 87100 total ==> SRR3207753.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 27 9.79784 Potri.005G024800.1.v4.1 1035 936 2 1.48798 Potri.004G059700.1.v4.1 961 862 1 0.807857 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 12.1357 2.97152 Potri.016G087400.1.v4.1 270 171 31 126.243 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 4.42015 1.83875 Potri.012G127500.1.v4.1 977 878 117 92.7968 ==> SRR3207753.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 125 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 19 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207753 completed mapping pipeline successfully