Starting /dee2/code/volunteer_pipeline.sh SRR3207754 current disk space = 3056268832768 free memory = 1304038704 SRR3207754 SRAfilesize a02a0e0084ea2ddd1cfde8a2435b638d SRR3207754.sra SRR3207754.sra file validated SRR3207754 is single end SRR3207754 is conventional basespace SRR3207754 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207754_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.0075 40.0 38.0 40.0 35.0 40.0 2 37.956 40.0 38.0 40.0 35.0 40.0 3 37.88825 40.0 38.0 40.0 34.0 40.0 4 37.87675 40.0 38.0 40.0 35.0 40.0 5 37.84925 40.0 38.0 40.0 35.0 40.0 6 37.9635 40.0 38.0 40.0 35.0 40.0 7 38.066 40.0 38.0 40.0 35.0 40.0 8 37.959 40.0 38.0 40.0 34.0 40.0 9 37.939 40.0 38.0 40.0 35.0 40.0 10 37.924 40.0 38.0 40.0 34.0 40.0 11 38.203 40.0 38.0 40.0 35.0 40.0 12 38.06325 40.0 38.0 40.0 34.0 40.0 13 38.007 39.0 38.0 40.0 33.0 40.0 14 38.06775 39.0 38.0 40.0 34.0 40.0 15 38.02 40.0 38.0 40.0 34.0 40.0 16 38.01575 39.0 38.0 40.0 35.0 40.0 17 37.9145 39.0 38.0 40.0 33.0 40.0 18 37.946 39.0 38.0 40.0 34.0 40.0 19 37.8535 39.0 38.0 40.0 33.0 40.0 20 37.75775 39.0 38.0 40.0 33.0 40.0 21 37.7635 39.0 38.0 40.0 33.0 40.0 22 37.784 39.0 38.0 40.0 33.0 40.0 23 37.607 39.0 38.0 40.0 33.0 40.0 24 37.595 39.0 38.0 40.0 33.0 40.0 25 37.476 39.0 37.0 40.0 33.0 40.0 26 37.44025 39.0 38.0 40.0 33.0 40.0 27 37.51675 39.0 38.0 40.0 33.0 40.0 28 37.44475 39.0 38.0 40.0 33.0 40.0 29 37.445 39.0 38.0 40.0 33.0 40.0 30 37.27075 39.0 37.0 40.0 33.0 40.0 31 37.3 39.0 37.0 40.0 33.0 40.0 32 37.3175 39.0 37.0 40.0 33.0 40.0 33 37.3115 39.0 38.0 40.0 33.0 40.0 34 37.27175 39.0 37.0 40.0 33.0 40.0 35 37.1335 39.0 37.0 40.0 33.0 40.0 36 37.134 39.0 37.0 40.0 33.0 40.0 37 37.23025 39.0 37.0 40.0 33.0 40.0 38 36.9725 39.0 36.0 40.0 32.0 40.0 39 37.02775 39.0 37.0 40.0 32.0 40.0 40 36.8595 39.0 36.0 40.0 32.0 40.0 41 36.899 39.0 36.0 40.0 32.0 40.0 42 36.617 39.0 36.0 40.0 31.0 40.0 43 36.66525 39.0 36.0 40.0 31.0 40.0 44 36.6065 39.0 36.0 40.0 31.0 40.0 45 36.44775 39.0 36.0 40.0 31.0 40.0 46 36.5515 39.0 36.0 40.0 31.0 40.0 47 36.012 39.0 35.0 40.0 30.0 40.0 48 36.28225 39.0 36.0 40.0 31.0 40.0 49 36.10675 39.0 35.0 40.0 31.0 40.0 50 36.03225 39.0 35.0 40.0 31.0 40.0 51 35.9655 39.0 35.0 40.0 31.0 40.0 52 35.87175 38.0 35.0 39.0 31.0 40.0 53 35.72575 38.0 35.0 39.0 30.0 40.0 54 35.5575 38.0 35.0 39.0 30.0 40.0 55 35.471 38.0 35.0 39.0 30.0 40.0 56 35.41175 38.0 35.0 39.0 30.0 40.0 57 35.28825 38.0 35.0 39.0 30.0 40.0 58 35.0145 38.0 34.0 39.0 29.0 40.0 59 34.7885 38.0 34.0 39.0 29.0 40.0 60 34.721 37.0 34.0 39.0 29.0 40.0 61 34.723 38.0 34.0 39.0 29.0 40.0 62 34.36925 37.0 34.0 39.0 28.0 40.0 63 33.98375 36.0 33.0 39.0 27.0 39.0 64 33.974 36.0 33.0 39.0 27.0 39.0 65 34.01975 37.0 33.0 39.0 28.0 39.0 66 33.683 36.0 33.0 39.0 27.0 39.0 67 33.35375 36.0 33.0 38.0 25.0 39.0 68 32.7965 36.0 32.0 38.0 23.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 4.0 9 3.0 10 5.0 11 1.0 12 5.0 13 3.0 14 6.0 15 4.0 16 7.0 17 5.0 18 10.0 19 7.0 20 13.0 21 13.0 22 12.0 23 16.0 24 13.0 25 19.0 26 25.0 27 29.0 28 38.0 29 51.0 30 48.0 31 77.0 32 71.0 33 106.0 34 131.0 35 197.0 36 288.0 37 487.0 38 839.0 39 1456.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.549658832448824 14.227950467525904 17.0078342178418 43.214556482183475 2 19.025 25.15 37.075 18.75 3 23.175 27.925 26.974999999999998 21.925 4 24.2 34.1 19.85 21.85 5 24.375 35.449999999999996 22.400000000000002 17.775 6 17.9 36.75 25.05 20.3 7 16.175 16.525000000000002 45.0 22.3 8 19.375 23.775 29.375 27.474999999999998 9 19.375 23.674999999999997 31.225 25.724999999999998 10 20.525 38.550000000000004 24.125 16.8 11 24.55 28.000000000000004 20.974999999999998 26.474999999999998 12 21.075 23.7 30.0 25.224999999999998 13 19.8 28.599999999999998 30.0 21.6 14 20.724999999999998 27.800000000000004 30.15 21.325 15 22.425 26.825 28.599999999999998 22.15 16 21.125 28.725 27.250000000000004 22.900000000000002 17 20.8 27.125 28.000000000000004 24.075 18 21.175 28.225 28.125 22.475 19 21.224999999999998 28.375 28.65 21.75 20 22.175 26.75 28.95 22.125 21 20.0 30.475 27.725 21.8 22 22.825 28.199999999999996 26.650000000000002 22.325 23 22.675 28.525 27.474999999999998 21.325 24 21.675 29.099999999999998 27.750000000000004 21.475 25 22.325 27.05 28.4 22.225 26 21.175 28.325 27.900000000000002 22.6 27 23.724999999999998 26.424999999999997 27.200000000000003 22.650000000000002 28 20.849999999999998 29.525000000000002 27.700000000000003 21.925 29 21.224999999999998 28.050000000000004 28.849999999999998 21.875 30 21.025 28.175 28.1 22.7 31 21.099999999999998 28.825 28.275 21.8 32 21.375 29.475 27.375 21.775 33 21.475 28.825 27.900000000000002 21.8 34 22.075 29.225 27.775 20.925 35 22.45 28.375 28.050000000000004 21.125 36 21.925 28.625 27.675 21.775 37 21.275 28.15 27.650000000000002 22.925 38 21.05 28.825 27.775 22.35 39 21.2 29.849999999999998 26.6 22.35 40 21.8 29.675 27.900000000000002 20.625 41 21.275 29.175 28.15 21.4 42 22.325 27.125 28.95 21.6 43 20.95 30.15 27.150000000000002 21.75 44 20.3 28.775000000000002 28.65 22.275 45 22.25 27.950000000000003 26.8 23.0 46 20.575 29.15 28.575 21.7 47 22.15 29.349999999999998 27.325 21.175 48 21.95 27.950000000000003 28.275 21.825 49 22.125 27.55 28.749999999999996 21.575 50 21.15 27.224999999999998 28.425 23.200000000000003 51 21.675 28.775000000000002 27.875 21.675 52 21.375 27.725 27.625 23.275000000000002 53 20.474999999999998 28.299999999999997 28.7 22.525000000000002 54 21.2 28.425 28.125 22.25 55 22.15 27.650000000000002 27.775 22.425 56 20.825 28.475 28.1 22.6 57 21.95 27.85 28.525 21.675 58 21.025 28.549999999999997 27.700000000000003 22.725 59 21.85 28.000000000000004 28.299999999999997 21.85 60 21.45 28.299999999999997 27.650000000000002 22.6 61 22.05 28.275 28.050000000000004 21.625 62 20.375 29.275000000000002 28.749999999999996 21.6 63 22.625 28.1 27.0 22.275 64 21.099999999999998 29.599999999999998 28.349999999999998 20.95 65 22.275 28.325 27.975 21.425 66 22.400000000000002 27.525 27.650000000000002 22.425 67 22.225 26.8 29.175 21.8 68 21.85 29.275000000000002 26.924999999999997 21.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 4.0 22 5.0 23 7.0 24 9.0 25 9.0 26 10.5 27 19.5 28 27.0 29 40.0 30 54.0 31 55.0 32 72.5 33 95.5 34 101.0 35 114.0 36 162.0 37 197.0 38 218.0 39 268.0 40 306.5 41 316.0 42 323.0 43 339.0 44 348.0 45 361.0 46 334.0 47 294.0 48 285.5 49 253.5 50 230.0 51 191.5 52 147.0 53 141.0 54 119.0 55 77.0 56 57.0 57 53.0 58 45.0 59 41.0 60 31.5 61 18.0 62 14.0 63 13.0 64 9.0 65 5.5 66 5.0 67 2.5 68 1.5 69 3.0 70 2.0 71 2.0 72 3.0 73 2.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84947315604616 99.5 2 0.10035122930255895 0.2 3 0.0 0.0 4 0.0 0.0 5 0.025087807325639738 0.125 6 0.0 0.0 7 0.025087807325639738 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAA 7 0.17500000000000002 TruSeq Adapter, Index 4 (100% over 63bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGAAAAA 5 0.125 TruSeq Adapter, Index 4 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.175 0.0 0.0 0.0 0.0 2 0.175 0.0 0.0 0.0 0.0 3 0.175 0.0 0.0 0.0 0.0 4 0.175 0.0 0.0 0.0 0.0 5 0.175 0.0 0.0 0.0 0.0 6 0.175 0.0 0.0 0.0 0.0 7 0.175 0.0 0.0 0.0 0.0 8 0.175 0.0 0.0 0.0 0.0 9 0.175 0.0 0.0 0.0 0.0 10 0.175 0.0 0.0 0.0 0.0 11 0.175 0.0 0.0 0.0 0.0 12 0.175 0.0 0.0 0.0 0.0 13 0.175 0.0 0.0 0.0 0.0 14 0.175 0.0 0.0 0.0 0.0 15 0.175 0.0 0.0 0.0 0.0 16 0.175 0.0 0.0 0.0 0.0 17 0.175 0.0 0.0 0.0 0.0 18 0.175 0.0 0.0 0.0 0.0 19 0.175 0.0 0.0 0.0 0.0 20 0.175 0.0 0.0 0.0 0.0 21 0.175 0.0 0.0 0.0 0.0 22 0.2 0.0 0.0 0.0 0.0 23 0.2 0.0 0.0 0.0 0.0 24 0.2 0.0 0.0 0.0 0.0 25 0.2 0.0 0.0 0.0 0.0 26 0.2 0.0 0.0 0.0 0.0 27 0.2 0.0 0.0 0.0 0.0 28 0.225 0.0 0.0 0.0 0.0 29 0.225 0.0 0.0 0.0 0.0 30 0.225 0.0 0.0 0.0 0.0 31 0.225 0.0 0.0 0.0 0.0 32 0.225 0.0 0.0 0.0 0.0 33 0.225 0.0 0.0 0.0 0.0 34 0.225 0.0 0.0 0.0 0.0 35 0.225 0.0 0.0 0.0 0.0 36 0.225 0.0 0.0 0.0 0.0 37 0.225 0.0 0.0 0.0 0.0 38 0.225 0.0 0.0 0.0 0.0 39 0.225 0.0 0.0 0.0 0.0 40 0.225 0.0 0.0 0.0 0.0 41 0.225 0.0 0.0 0.0 0.0 42 0.225 0.0 0.0 0.0 0.0 43 0.225 0.0 0.0 0.0 0.0 44 0.225 0.0 0.0 0.0 0.0 45 0.225 0.0 0.0 0.0 0.0 46 0.225 0.0 0.0 0.0 0.0 47 0.225 0.0 0.0 0.0 0.0 48 0.225 0.0 0.0 0.0 0.0 49 0.225 0.0 0.0 0.0 0.0 50 0.225 0.0 0.0 0.0 0.0 51 0.225 0.0 0.0 0.0 0.0 52 0.225 0.0 0.0 0.0 0.0 53 0.225 0.0 0.0 0.0 0.0 54 0.225 0.0 0.0 0.0 0.0 55 0.225 0.0 0.0 0.0 0.0 56 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra Read 235781 spots for SRR3207754.sra Written 235781 spots for SRR3207754.sra SRR ids: ['SRR3207754.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dwa4o23n SRR3207754.sra spots: 4715620 blocks: [[1, 235781], [235782, 471562], [471563, 707343], [707344, 943124], [943125, 1178905], [1178906, 1414686], [1414687, 1650467], [1650468, 1886248], [1886249, 2122029], [2122030, 2357810], [2357811, 2593591], [2593592, 2829372], [2829373, 3065153], [3065154, 3300934], [3300935, 3536715], [3536716, 3772496], [3772497, 4008277], [4008278, 4244058], [4244059, 4479839], [4479840, 4715620]] SRR3207754 file size 985179 SRR3207754 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207754 SRR3207754_1.fastq Input file: SRR3207754_1.fastq trimmed: SRR3207754-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:04:36 2025 >> started Mon Feb 10 20:04:39 2025 >> done (2.474s) 4715620 reads processed; of these: 11829 ( 0.25%) short reads filtered out after trimming by size control 49019 ( 1.04%) empty reads filtered out after trimming by size control 4654772 (98.71%) reads available; of these: 219134 ( 4.71%) trimmed reads available after processing 4435638 (95.29%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 905 0.02% 19 1423 0.03% 20 3139 0.07% 21 746 0.02% 22 897 0.02% 23 1408 0.03% 24 2054 0.04% 25 3953 0.08% 26 1086 0.02% 27 1119 0.02% 28 1492 0.03% 29 2371 0.05% 30 4033 0.09% 31 1093 0.02% 32 1368 0.03% 33 1570 0.03% 34 2353 0.05% 35 4164 0.09% 36 1081 0.02% 37 1354 0.03% 38 1975 0.04% 39 3225 0.07% 40 6026 0.13% 41 1356 0.03% 42 1742 0.04% 43 2397 0.05% 44 4001 0.09% 45 7737 0.17% 46 1519 0.03% 47 2050 0.04% 48 2975 0.06% 49 4873 0.10% 50 8971 0.19% 51 1938 0.04% 52 2502 0.05% 53 3764 0.08% 54 6447 0.14% 55 12916 0.28% 56 2461 0.05% 57 3372 0.07% 58 5076 0.11% 59 8989 0.19% 60 20812 0.45% 61 3236 0.07% 62 4652 0.10% 63 6785 0.15% 64 11766 0.25% 65 23443 0.50% 66 4000 0.09% 67 10519 0.23% 68 4435638 95.29% 4654772 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=34 prefix-density=0.04 prefix-fanout=2.4 sequence=GGTGCAAAGATGGTTA criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=200.41 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=22.0 sequence=TTCTTCTTCTTC Started job on | Feb 10 20:04:55 Started mapping on | Feb 10 20:04:55 Finished on | Feb 10 20:05:01 Mapping speed, Million of reads per hour | 2792.86 Number of input reads | 4654772 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 4390229 Uniquely mapped reads % | 94.32% Average mapped length | 67.13 Number of splices: Total | 823263 Number of splices: Annotated (sjdb) | 809766 Number of splices: GT/AG | 811446 Number of splices: GC/AG | 9630 Number of splices: AT/AC | 959 Number of splices: Non-canonical | 1228 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.78 Insertion rate per base | 0.01% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 149083 % of reads mapped to multiple loci | 3.20% Number of reads mapped to too many loci | 84918 % of reads mapped to too many loci | 1.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 115460 115460 115460 N_multimapping 149083 149083 149083 N_noFeature 212210 2287096 2283349 N_ambiguous 46115 6876 7276 UnstrandedReadsAssigned:4131904 PositiveStrandReadsAssigned:2096257 NegativeStrandReadsAssigned:2099604 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207754 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207754-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,654,772 reads, 4,310,030 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR3207754.ke.tsv 34699 SRR3207754.se.tsv 87100 total ==> SRR3207754.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 125 22.79 Potri.005G024800.1.v4.1 1035 936 21 7.8497 Potri.004G059700.1.v4.1 961 862 3 1.21765 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 69.6004 8.56232 Potri.016G087400.1.v4.1 270 171 155 317.136 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 14 2.92605 Potri.012G127500.1.v4.1 977 878 394 157.004 ==> SRR3207754.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 670 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 70 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207754 completed mapping pipeline successfully