Starting /dee2/code/volunteer_pipeline.sh SRR3207755 current disk space = 3056064770048 free memory = 1580123936 SRR3207755 SRAfilesize 88ad7f6fc92808005de0b9875b935abf SRR3207755.sra SRR3207755.sra file validated SRR3207755 is single end SRR3207755 is conventional basespace SRR3207755 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207755_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.174 40.0 38.0 40.0 33.0 40.0 2 37.2645 40.0 38.0 40.0 33.0 40.0 3 37.17275 40.0 38.0 40.0 33.0 40.0 4 37.24675 39.0 38.0 40.0 33.0 40.0 5 37.12825 39.0 38.0 40.0 33.0 40.0 6 37.3755 39.0 38.0 40.0 33.0 40.0 7 37.436 39.0 38.0 40.0 33.0 40.0 8 37.35575 39.0 38.0 40.0 33.0 40.0 9 37.36725 39.0 38.0 40.0 33.0 40.0 10 37.40475 39.0 38.0 40.0 33.0 40.0 11 37.91775 39.0 38.0 40.0 34.0 40.0 12 37.7865 39.0 38.0 40.0 33.0 40.0 13 37.709 39.0 38.0 40.0 33.0 40.0 14 37.81925 39.0 38.0 40.0 33.0 40.0 15 37.68575 39.0 38.0 40.0 33.0 40.0 16 37.77575 39.0 38.0 40.0 33.0 40.0 17 37.63275 39.0 38.0 40.0 33.0 40.0 18 37.608 39.0 38.0 40.0 33.0 40.0 19 37.51425 39.0 38.0 40.0 33.0 40.0 20 37.43625 39.0 38.0 40.0 33.0 40.0 21 37.4015 39.0 38.0 40.0 33.0 40.0 22 37.41925 39.0 38.0 40.0 33.0 40.0 23 37.291 39.0 37.0 40.0 32.0 40.0 24 37.3195 39.0 37.0 40.0 33.0 40.0 25 37.094 39.0 36.0 40.0 31.0 40.0 26 37.0835 39.0 36.0 40.0 32.0 40.0 27 37.1845 39.0 37.0 40.0 32.0 40.0 28 37.091 39.0 37.0 40.0 32.0 40.0 29 36.95725 39.0 36.0 40.0 31.0 40.0 30 36.9455 39.0 36.0 40.0 31.0 40.0 31 36.905 39.0 36.0 40.0 31.0 40.0 32 36.8755 39.0 36.0 40.0 31.0 40.0 33 36.9135 39.0 36.0 40.0 31.0 40.0 34 36.87325 39.0 36.0 40.0 31.0 40.0 35 36.776 39.0 36.0 40.0 31.0 40.0 36 36.72875 39.0 36.0 40.0 31.0 40.0 37 36.8465 39.0 36.0 40.0 31.0 40.0 38 36.537 39.0 36.0 40.0 31.0 40.0 39 36.67025 39.0 36.0 40.0 31.0 40.0 40 36.33725 39.0 36.0 40.0 31.0 40.0 41 36.46825 39.0 36.0 40.0 31.0 40.0 42 36.21925 39.0 35.0 40.0 31.0 40.0 43 36.1875 39.0 35.0 40.0 31.0 40.0 44 36.06375 39.0 35.0 40.0 31.0 40.0 45 35.93825 39.0 35.0 40.0 31.0 40.0 46 35.904 39.0 35.0 39.0 31.0 40.0 47 35.40775 38.0 35.0 39.0 30.0 40.0 48 35.61275 38.0 35.0 39.0 30.0 40.0 49 35.4865 38.0 35.0 39.0 29.0 40.0 50 35.4145 38.0 35.0 39.0 30.0 40.0 51 35.13425 38.0 35.0 39.0 29.0 40.0 52 34.983 38.0 34.0 39.0 29.0 40.0 53 34.89525 38.0 34.0 39.0 29.0 40.0 54 34.74925 38.0 34.0 39.0 28.0 40.0 55 34.62875 38.0 34.0 39.0 28.0 40.0 56 34.55375 38.0 34.0 39.0 29.0 40.0 57 34.36125 37.0 33.0 39.0 28.0 40.0 58 34.13225 37.0 33.0 39.0 27.0 40.0 59 33.751 36.0 33.0 39.0 26.0 39.0 60 33.654 36.0 33.0 39.0 26.0 39.0 61 33.63975 36.0 33.0 39.0 26.0 39.0 62 33.3875 36.0 33.0 38.0 26.0 39.0 63 32.8485 36.0 33.0 38.0 24.0 39.0 64 32.9705 36.0 33.0 38.0 25.0 39.0 65 32.9565 36.0 33.0 38.0 25.0 39.0 66 32.589 36.0 33.0 38.0 23.0 39.0 67 32.1165 35.0 32.0 38.0 23.0 39.0 68 31.54375 35.0 31.0 38.0 20.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 0.0 4 0.0 5 0.0 6 3.0 7 1.0 8 2.0 9 3.0 10 3.0 11 3.0 12 7.0 13 6.0 14 8.0 15 9.0 16 1.0 17 9.0 18 6.0 19 10.0 20 19.0 21 11.0 22 21.0 23 20.0 24 23.0 25 38.0 26 40.0 27 39.0 28 53.0 29 71.0 30 50.0 31 45.0 32 73.0 33 98.0 34 168.0 35 219.0 36 336.0 37 481.0 38 987.0 39 1115.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.05812451562904 15.164040299664169 17.85068457762852 41.927150607078275 2 20.325 25.324999999999996 35.825 18.525 3 22.075 29.375 26.1 22.45 4 25.85 31.4 20.9 21.85 5 23.375 36.25 22.25 18.125 6 18.275 37.05 23.799999999999997 20.875 7 16.75 16.125 44.0 23.125 8 20.8 22.975 28.499999999999996 27.725 9 19.575 22.0 31.974999999999998 26.450000000000003 10 19.725 38.550000000000004 24.099999999999998 17.625 11 27.1 27.275 20.775 24.85 12 20.525 24.25 29.65 25.575 13 19.1 28.375 30.3 22.225 14 20.375 27.675 30.049999999999997 21.9 15 22.025 27.250000000000004 27.35 23.375 16 22.3 27.250000000000004 27.025 23.425 17 23.225 27.875 27.1 21.8 18 21.375 28.349999999999998 28.599999999999998 21.675 19 21.85 28.325 27.725 22.1 20 21.65 27.55 28.050000000000004 22.75 21 21.224999999999998 28.775000000000002 26.875 23.125 22 22.5 27.975 28.425 21.099999999999998 23 21.425 28.299999999999997 28.075 22.2 24 20.925 29.15 27.525 22.400000000000002 25 22.25 29.5 26.775 21.475 26 22.005501375343837 29.132283070767688 26.881720430107524 21.980495123780948 27 20.974999999999998 28.9 28.000000000000004 22.125 28 21.975 28.375 27.700000000000003 21.95 29 22.275 28.1 28.549999999999997 21.075 30 22.425 27.500000000000004 27.675 22.400000000000002 31 23.05 28.525 27.175 21.25 32 23.05 28.675 26.625 21.65 33 21.775 28.599999999999998 27.474999999999998 22.15 34 20.549999999999997 28.625 28.725 22.1 35 21.75 28.9 28.1 21.25 36 22.225 28.799999999999997 27.6 21.375 37 21.075 28.1 27.925 22.900000000000002 38 21.975 28.325 27.700000000000003 22.0 39 20.849999999999998 29.075 28.449999999999996 21.625 40 20.5 29.099999999999998 27.575 22.825 41 21.7 28.000000000000004 27.900000000000002 22.400000000000002 42 21.85 27.55 27.85 22.75 43 21.5 27.6 29.225 21.675 44 21.775 28.175 27.975 22.075 45 21.9 28.549999999999997 27.025 22.525000000000002 46 19.925 29.15 28.349999999999998 22.575 47 22.7 28.050000000000004 26.825 22.425 48 20.974999999999998 29.375 27.450000000000003 22.2 49 21.275 27.825 28.65 22.25 50 21.875 29.175 27.025 21.925 51 21.15 28.549999999999997 27.450000000000003 22.85 52 21.05 28.15 28.499999999999996 22.3 53 22.925 27.474999999999998 27.400000000000002 22.2 54 20.424999999999997 28.675 28.299999999999997 22.6 55 21.25 28.599999999999998 27.700000000000003 22.45 56 22.675 28.625 27.025 21.675 57 21.224999999999998 28.799999999999997 27.6 22.375 58 21.6 28.425 27.950000000000003 22.025 59 22.375 27.3 28.549999999999997 21.775 60 21.775 26.75 29.15 22.325 61 21.275 27.775 27.950000000000003 23.0 62 21.95 28.449999999999996 28.125 21.475 63 21.2 26.525 28.95 23.325000000000003 64 21.9 26.8 29.525000000000002 21.775 65 21.825 27.825 28.65 21.7 66 22.15 28.025 28.299999999999997 21.525 67 22.925 27.450000000000003 27.0 22.625 68 21.625 29.049999999999997 27.35 21.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 3.0 20 1.5 21 1.5 22 3.0 23 5.5 24 9.0 25 10.0 26 15.0 27 22.5 28 25.0 29 31.0 30 47.0 31 57.0 32 57.5 33 85.0 34 112.0 35 135.5 36 167.5 37 176.0 38 203.5 39 254.5 40 287.5 41 297.0 42 320.0 43 360.0 44 377.0 45 375.5 46 327.5 47 281.0 48 282.5 49 254.0 50 224.0 51 203.0 52 148.0 53 114.0 54 99.0 55 84.0 56 84.0 57 69.0 58 43.5 59 33.0 60 31.5 61 25.5 62 21.0 63 15.5 64 10.5 65 7.5 66 4.0 67 3.5 68 3.0 69 3.0 70 3.0 71 2.0 72 1.0 73 1.5 74 1.0 75 0.0 76 0.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.025 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87481221832749 99.725 2 0.10015022533800699 0.2 3 0.025037556334501748 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509506 spots for SRR3207755.sra Written 509506 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra Read 509501 spots for SRR3207755.sra Written 509501 spots for SRR3207755.sra SRR ids: ['SRR3207755.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zuyq4clt SRR3207755.sra spots: 10190025 blocks: [[1, 509501], [509502, 1019002], [1019003, 1528503], [1528504, 2038004], [2038005, 2547505], [2547506, 3057006], [3057007, 3566507], [3566508, 4076008], [4076009, 4585509], [4585510, 5095010], [5095011, 5604511], [5604512, 6114012], [6114013, 6623513], [6623514, 7133014], [7133015, 7642515], [7642516, 8152016], [8152017, 8661517], [8661518, 9171018], [9171019, 9680519], [9680520, 10190025]] SRR3207755 file size 2130336 SRR3207755 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207755 SRR3207755_1.fastq Input file: SRR3207755_1.fastq trimmed: SRR3207755-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:26:09 2025 >> started Mon Feb 10 20:26:14 2025 >> done (5.179s) 10190025 reads processed; of these: 25602 ( 0.25%) short reads filtered out after trimming by size control 82659 ( 0.81%) empty reads filtered out after trimming by size control 10081764 (98.94%) reads available; of these: 483316 ( 4.79%) trimmed reads available after processing 9598448 (95.21%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2137 0.02% 19 2927 0.03% 20 5431 0.05% 21 1494 0.01% 22 2014 0.02% 23 2814 0.03% 24 4761 0.05% 25 8585 0.09% 26 2177 0.02% 27 2434 0.02% 28 3255 0.03% 29 5170 0.05% 30 8860 0.09% 31 2385 0.02% 32 3092 0.03% 33 3340 0.03% 34 5223 0.05% 35 9123 0.09% 36 2531 0.03% 37 3049 0.03% 38 4330 0.04% 39 7095 0.07% 40 13569 0.13% 41 2967 0.03% 42 3788 0.04% 43 5513 0.05% 44 8970 0.09% 45 16813 0.17% 46 3564 0.04% 47 4532 0.04% 48 6492 0.06% 49 11027 0.11% 50 19826 0.20% 51 4332 0.04% 52 5667 0.06% 53 8328 0.08% 54 13948 0.14% 55 28442 0.28% 56 5586 0.06% 57 7549 0.07% 58 11473 0.11% 59 19618 0.19% 60 46346 0.46% 61 7368 0.07% 62 10021 0.10% 63 15178 0.15% 64 26157 0.26% 65 51168 0.51% 66 8984 0.09% 67 23863 0.24% 68 9598448 95.21% 10081764 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=18.26 fanout-score-rank=7 prefix-density=0.09 prefix-fanout=7.3 sequence=TGGAGGTGGAGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=189.21 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=21.1 sequence=TTCTTCTTCTTC Started job on | Feb 10 20:26:30 Started mapping on | Feb 10 20:26:31 Finished on | Feb 10 20:26:39 Mapping speed, Million of reads per hour | 4536.79 Number of input reads | 10081764 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 9430203 Uniquely mapped reads % | 93.54% Average mapped length | 67.11 Number of splices: Total | 1766862 Number of splices: Annotated (sjdb) | 1738674 Number of splices: GT/AG | 1741017 Number of splices: GC/AG | 21247 Number of splices: AT/AC | 1923 Number of splices: Non-canonical | 2675 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323611 % of reads mapped to multiple loci | 3.21% Number of reads mapped to too many loci | 267886 % of reads mapped to too many loci | 2.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 327950 327950 327950 N_multimapping 323611 323611 323611 N_noFeature 441520 4904533 4899706 N_ambiguous 97201 14524 15280 UnstrandedReadsAssigned:8891482 PositiveStrandReadsAssigned:4511146 NegativeStrandReadsAssigned:4515217 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207755 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207755-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,081,764 reads, 9,352,586 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,016 rounds 52401 SRR3207755.ke.tsv 34699 SRR3207755.se.tsv 87100 total ==> SRR3207755.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 260 21.2899 Potri.005G024800.1.v4.1 1035 936 38 6.37944 Potri.004G059700.1.v4.1 961 862 9 1.64063 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 123.32 6.81364 Potri.016G087400.1.v4.1 270 171 353 324.38 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 44.5906 4.18565 Potri.012G127500.1.v4.1 977 878 1222 218.701 ==> SRR3207755.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1222 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 126 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207755 completed mapping pipeline successfully