Starting /dee2/code/volunteer_pipeline.sh SRR3207756 current disk space = 3056079646720 free memory = 1578115036 SRR3207756 SRAfilesize 1d225e7f6fb01d0268c15830f387ffb9 SRR3207756.sra SRR3207756.sra file validated SRR3207756 is single end SRR3207756 is conventional basespace SRR3207756 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207756_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.431 40.0 38.0 40.0 35.0 40.0 2 38.2455 40.0 38.0 40.0 35.0 40.0 3 38.19025 40.0 38.0 40.0 35.0 40.0 4 38.215 40.0 38.0 40.0 35.0 40.0 5 38.17425 39.0 38.0 40.0 35.0 40.0 6 38.1965 40.0 38.0 40.0 35.0 40.0 7 38.1965 39.0 38.0 40.0 35.0 40.0 8 38.14125 39.0 38.0 40.0 35.0 40.0 9 38.09425 39.0 38.0 40.0 35.0 40.0 10 38.10475 39.0 38.0 40.0 35.0 40.0 11 37.9835 39.0 38.0 40.0 35.0 40.0 12 37.92575 39.0 38.0 40.0 34.0 40.0 13 37.9145 39.0 38.0 40.0 33.0 40.0 14 37.90875 39.0 38.0 40.0 33.0 40.0 15 37.84925 39.0 38.0 40.0 33.0 40.0 16 37.822 39.0 38.0 40.0 33.0 40.0 17 37.6395 39.0 38.0 40.0 33.0 40.0 18 37.65425 39.0 38.0 40.0 33.0 40.0 19 37.63325 39.0 38.0 40.0 33.0 40.0 20 37.59025 39.0 38.0 40.0 33.0 40.0 21 37.51425 39.0 38.0 40.0 33.0 40.0 22 37.39725 39.0 38.0 40.0 33.0 40.0 23 37.41125 39.0 38.0 40.0 33.0 40.0 24 37.36525 39.0 37.0 40.0 33.0 40.0 25 37.292 39.0 38.0 40.0 33.0 40.0 26 37.13675 39.0 37.0 40.0 33.0 40.0 27 37.03825 39.0 37.0 40.0 32.0 40.0 28 37.01525 39.0 37.0 40.0 33.0 40.0 29 36.89275 39.0 36.0 40.0 32.0 40.0 30 36.82475 39.0 36.0 40.0 31.0 40.0 31 36.72025 39.0 36.0 40.0 31.0 40.0 32 36.538 39.0 36.0 40.0 31.0 40.0 33 36.594 39.0 36.0 40.0 31.0 40.0 34 36.4545 39.0 36.0 40.0 30.0 40.0 35 36.35275 39.0 36.0 40.0 30.0 40.0 36 36.5555 39.0 36.0 40.0 31.0 40.0 37 36.388 39.0 36.0 40.0 30.0 40.0 38 36.265 39.0 36.0 40.0 30.0 40.0 39 36.113 39.0 36.0 40.0 29.0 40.0 40 35.973 39.0 35.0 40.0 29.0 40.0 41 35.85325 39.0 35.0 40.0 30.0 40.0 42 35.77225 39.0 35.0 40.0 30.0 40.0 43 35.72225 39.0 35.0 40.0 30.0 40.0 44 35.52475 38.0 35.0 40.0 29.0 40.0 45 35.43375 38.0 35.0 39.0 29.0 40.0 46 35.379 38.0 35.0 39.0 29.0 40.0 47 35.168 38.0 35.0 39.0 28.0 40.0 48 35.04425 38.0 35.0 39.0 28.0 40.0 49 34.92425 38.0 35.0 39.0 28.0 40.0 50 34.76175 38.0 35.0 39.0 28.0 40.0 51 34.684 38.0 35.0 39.0 28.0 40.0 52 34.55075 38.0 34.0 39.0 28.0 40.0 53 34.4205 38.0 34.0 39.0 27.0 40.0 54 34.1665 37.0 34.0 39.0 26.0 40.0 55 34.05575 37.0 33.0 39.0 27.0 40.0 56 33.86275 37.0 33.0 39.0 26.0 39.0 57 33.546 36.0 33.0 39.0 26.0 39.0 58 33.42825 36.0 33.0 39.0 25.0 39.0 59 33.2625 36.0 33.0 38.0 24.0 39.0 60 32.979 36.0 33.0 38.0 24.0 39.0 61 32.65325 36.0 33.0 38.0 23.0 39.0 62 32.43 36.0 33.0 38.0 21.0 39.0 63 32.2875 36.0 32.0 38.0 21.0 39.0 64 32.0005 35.0 32.0 38.0 21.0 39.0 65 31.852 35.0 32.0 38.0 19.0 39.0 66 31.57425 35.0 32.0 38.0 16.0 39.0 67 31.384 35.0 31.0 38.0 2.0 39.0 68 30.92425 35.0 31.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 2.0 5 3.0 6 2.0 7 1.0 8 3.0 9 4.0 10 12.0 11 3.0 12 3.0 13 11.0 14 12.0 15 13.0 16 5.0 17 9.0 18 16.0 19 22.0 20 20.0 21 20.0 22 17.0 23 16.0 24 24.0 25 26.0 26 25.0 27 32.0 28 43.0 29 49.0 30 62.0 31 80.0 32 73.0 33 114.0 34 174.0 35 200.0 36 326.0 37 608.0 38 1083.0 39 882.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.8144072036018 13.681840920460232 15.957978989494748 41.545772886443224 2 22.375 20.925 33.050000000000004 23.65 3 24.0 25.3 25.624999999999996 25.074999999999996 4 26.400000000000002 29.775000000000002 20.925 22.900000000000002 5 27.55 32.4 22.225 17.825 6 20.424999999999997 36.75 24.349999999999998 18.475 7 18.075 19.575 42.675000000000004 19.675 8 19.925 24.7 29.875 25.5 9 19.25 23.674999999999997 33.175 23.9 10 20.674999999999997 36.85 26.325 16.150000000000002 11 24.575 29.275000000000002 23.375 22.775000000000002 12 21.05 25.674999999999997 29.575000000000003 23.7 13 19.475 28.025 31.324999999999996 21.175 14 20.325 27.85 30.925000000000004 20.9 15 21.675 27.725 28.275 22.325 16 20.125 27.775 29.2 22.900000000000002 17 22.55 28.825 27.85 20.775 18 22.325 28.050000000000004 27.900000000000002 21.725 19 21.675 28.825 29.025000000000002 20.474999999999998 20 22.900000000000002 28.175 27.85 21.075 21 20.8 28.749999999999996 28.599999999999998 21.85 22 21.175 28.9 28.199999999999996 21.725 23 21.725 29.025000000000002 27.0 22.25 24 21.099999999999998 28.225 28.15 22.525000000000002 25 22.875 27.825 27.275 22.025 26 21.7 28.749999999999996 27.625 21.925 27 21.325 27.525 28.475 22.675 28 22.2 29.299999999999997 26.674999999999997 21.825 29 22.425 27.35 28.425 21.8 30 21.825 27.55 28.349999999999998 22.275 31 21.875 27.275 29.125 21.725 32 21.9 27.025 28.499999999999996 22.575 33 21.325 27.750000000000004 28.549999999999997 22.375 34 21.975 28.175 28.025 21.825 35 23.055763940985248 27.93198299574894 27.506876719179797 21.50537634408602 36 22.325 27.175 27.450000000000003 23.05 37 21.43035758939735 27.981995498874717 29.057264316079017 21.530382595648913 38 21.725 27.700000000000003 28.749999999999996 21.825 39 22.5 27.500000000000004 28.95 21.05 40 21.975 28.225 26.525 23.275000000000002 41 21.725 28.65 28.875 20.75 42 21.175 28.075 28.249999999999996 22.5 43 21.6 27.925 28.375 22.1 44 22.2 28.525 26.200000000000003 23.075000000000003 45 21.2 29.075 27.250000000000004 22.475 46 21.099999999999998 28.125 27.700000000000003 23.075000000000003 47 22.6 28.599999999999998 27.950000000000003 20.849999999999998 48 22.35 27.575 27.200000000000003 22.875 49 22.775000000000002 27.675 27.500000000000004 22.05 50 22.375 28.050000000000004 27.474999999999998 22.1 51 21.099999999999998 27.875 28.475 22.55 52 21.75 28.000000000000004 28.449999999999996 21.8 53 22.425 27.750000000000004 28.499999999999996 21.325 54 21.75 27.175 28.849999999999998 22.225 55 20.5 29.225 29.099999999999998 21.175 56 22.05 27.900000000000002 28.575 21.475 57 21.475 28.175 27.55 22.8 58 21.15 29.225 27.950000000000003 21.675 59 22.05 27.725 26.974999999999998 23.25 60 21.925 28.625 27.400000000000002 22.05 61 22.0 27.224999999999998 28.275 22.5 62 21.85 28.599999999999998 26.724999999999998 22.825 63 22.675 28.275 26.424999999999997 22.625 64 22.5 30.0 26.375 21.125 65 21.925 29.575000000000003 26.224999999999998 22.275 66 21.4 28.975 27.875 21.75 67 21.725 28.7 28.000000000000004 21.575 68 22.6 28.625 27.150000000000002 21.625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 14.0 1 8.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.5 11 2.0 12 2.0 13 3.5 14 3.5 15 2.0 16 2.0 17 2.5 18 2.5 19 2.0 20 2.0 21 2.5 22 3.0 23 4.5 24 7.0 25 8.0 26 11.0 27 13.0 28 12.0 29 22.5 30 37.5 31 42.0 32 54.0 33 78.0 34 90.0 35 100.5 36 133.5 37 156.0 38 180.5 39 239.0 40 299.5 41 326.0 42 346.0 43 374.0 44 382.0 45 371.0 46 345.0 47 330.0 48 296.5 49 257.0 50 251.0 51 214.5 52 171.0 53 164.0 54 135.5 55 90.0 56 73.0 57 57.5 58 39.5 59 37.0 60 31.5 61 19.0 62 12.0 63 9.0 64 5.0 65 4.5 66 5.0 67 4.0 68 2.0 69 1.0 70 1.0 71 1.0 72 1.0 73 1.5 74 3.0 75 4.0 76 2.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.025 36 0.0 37 0.025 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82394366197182 99.225 2 0.12575452716297786 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025150905432595575 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025150905432595575 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 14 0.35000000000000003 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTGAAAAA 7 0.17500000000000002 TruSeq Adapter, Index 1 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra Read 268521 spots for SRR3207756.sra Written 268521 spots for SRR3207756.sra SRR ids: ['SRR3207756.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a_uo0uo6 SRR3207756.sra spots: 5370420 blocks: [[1, 268521], [268522, 537042], [537043, 805563], [805564, 1074084], [1074085, 1342605], [1342606, 1611126], [1611127, 1879647], [1879648, 2148168], [2148169, 2416689], [2416690, 2685210], [2685211, 2953731], [2953732, 3222252], [3222253, 3490773], [3490774, 3759294], [3759295, 4027815], [4027816, 4296336], [4296337, 4564857], [4564858, 4833378], [4833379, 5101899], [5101900, 5370420]] SRR3207756 file size 1132639 SRR3207756 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207756 SRR3207756_1.fastq Input file: SRR3207756_1.fastq trimmed: SRR3207756-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:28:31 2025 >> started Mon Feb 10 20:28:33 2025 >> done (2.517s) 5370420 reads processed; of these: 19038 ( 0.35%) short reads filtered out after trimming by size control 32507 ( 0.61%) empty reads filtered out after trimming by size control 5318875 (99.04%) reads available; of these: 365507 ( 6.87%) trimmed reads available after processing 4953368 (93.13%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1176 0.02% 19 1878 0.04% 20 3606 0.07% 21 956 0.02% 22 1369 0.03% 23 2138 0.04% 24 3624 0.07% 25 7633 0.14% 26 1502 0.03% 27 1905 0.04% 28 2596 0.05% 29 4220 0.08% 30 7900 0.15% 31 1761 0.03% 32 2308 0.04% 33 2799 0.05% 34 4391 0.08% 35 7946 0.15% 36 1842 0.03% 37 2411 0.05% 38 3459 0.07% 39 5650 0.11% 40 10114 0.19% 41 2544 0.05% 42 2536 0.05% 43 3634 0.07% 44 6199 0.12% 45 10903 0.20% 46 2636 0.05% 47 3516 0.07% 48 5138 0.10% 49 9007 0.17% 50 16909 0.32% 51 3404 0.06% 52 4487 0.08% 53 6982 0.13% 54 12129 0.23% 55 23632 0.44% 56 4664 0.09% 57 5978 0.11% 58 8988 0.17% 59 16233 0.31% 60 35648 0.67% 61 5705 0.11% 62 7323 0.14% 63 10717 0.20% 64 19190 0.36% 65 35621 0.67% 66 5364 0.10% 67 13236 0.25% 68 4953368 93.13% 5318875 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=27 prefix-density=0.06 prefix-fanout=2.4 sequence=AGGGTTTTTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=123.93 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=10.3 sequence=TGGTGCTGGAGTAGGAGGTTTAGGTGTAAAGATATCAAGAGGAAGAAGCACCTTGTCAACCTGATAAACAGCTAACTGGT Started job on | Feb 10 20:28:46 Started mapping on | Feb 10 20:28:47 Finished on | Feb 10 20:28:53 Mapping speed, Million of reads per hour | 3191.33 Number of input reads | 5318875 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 5016394 Uniquely mapped reads % | 94.31% Average mapped length | 66.89 Number of splices: Total | 954632 Number of splices: Annotated (sjdb) | 937850 Number of splices: GT/AG | 940661 Number of splices: GC/AG | 11750 Number of splices: AT/AC | 1101 Number of splices: Non-canonical | 1120 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.83 Insertion rate per base | 0.01% Insertion average length | 1.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 170395 % of reads mapped to multiple loci | 3.20% Number of reads mapped to too many loci | 88567 % of reads mapped to too many loci | 1.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 132086 132086 132086 N_multimapping 170395 170395 170395 N_noFeature 200869 2557125 2624617 N_ambiguous 50758 7529 7765 UnstrandedReadsAssigned:4764767 PositiveStrandReadsAssigned:2451740 NegativeStrandReadsAssigned:2384012 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207756 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207756-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,318,875 reads, 4,947,640 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR3207756.ke.tsv 34699 SRR3207756.se.tsv 87100 total ==> SRR3207756.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 183 28.9708 Potri.005G024800.1.v4.1 1035 936 15 4.86855 Potri.004G059700.1.v4.1 961 862 1 0.352433 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 83.979 8.97068 Potri.016G087400.1.v4.1 270 171 214 380.191 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 22 3.99256 Potri.012G127500.1.v4.1 977 878 269 93.0769 ==> SRR3207756.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 954 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 87 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207756 completed mapping pipeline successfully