Starting /dee2/code/volunteer_pipeline.sh SRR3207757 current disk space = 3056701140992 free memory = 1069397664 SRR3207757 SRAfilesize cdb0562e52580b83629906cb9479a5b7 SRR3207757.sra SRR3207757.sra file validated SRR3207757 is single end SRR3207757 is conventional basespace SRR3207757 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207757_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.48575 40.0 38.0 40.0 35.0 40.0 2 38.236 40.0 38.0 40.0 35.0 40.0 3 38.212 40.0 38.0 40.0 35.0 40.0 4 38.27525 40.0 38.0 40.0 35.0 40.0 5 38.263 40.0 38.0 40.0 35.0 40.0 6 38.33025 40.0 38.0 40.0 35.0 40.0 7 38.217 40.0 38.0 40.0 35.0 40.0 8 38.16325 40.0 38.0 40.0 35.0 40.0 9 38.16075 40.0 38.0 40.0 35.0 40.0 10 38.089 39.0 38.0 40.0 35.0 40.0 11 38.037 39.0 38.0 40.0 35.0 40.0 12 37.9775 39.0 38.0 40.0 34.0 40.0 13 37.9525 39.0 38.0 40.0 33.0 40.0 14 37.9585 39.0 38.0 40.0 34.0 40.0 15 37.92575 39.0 38.0 40.0 33.0 40.0 16 37.9515 39.0 38.0 40.0 34.0 40.0 17 37.7785 39.0 38.0 40.0 33.0 40.0 18 37.786 39.0 38.0 40.0 33.0 40.0 19 37.69075 39.0 38.0 40.0 33.0 40.0 20 37.61325 39.0 38.0 40.0 33.0 40.0 21 37.61375 39.0 38.0 40.0 33.0 40.0 22 37.52025 39.0 38.0 40.0 33.0 40.0 23 37.46775 39.0 38.0 40.0 33.0 40.0 24 37.3815 39.0 38.0 40.0 33.0 40.0 25 37.38225 39.0 38.0 40.0 33.0 40.0 26 37.31625 39.0 38.0 40.0 33.0 40.0 27 37.17825 39.0 37.0 40.0 33.0 40.0 28 37.081 39.0 37.0 40.0 33.0 40.0 29 36.94225 39.0 37.0 40.0 33.0 40.0 30 36.74625 39.0 36.0 40.0 31.0 40.0 31 36.76925 39.0 36.0 40.0 32.0 40.0 32 36.53225 39.0 36.0 40.0 31.0 40.0 33 36.5195 39.0 36.0 40.0 31.0 40.0 34 36.444 39.0 36.0 40.0 30.0 40.0 35 36.46025 39.0 36.0 40.0 31.0 40.0 36 36.51325 39.0 36.0 40.0 31.0 40.0 37 36.44375 39.0 36.0 40.0 31.0 40.0 38 36.45425 39.0 36.0 40.0 31.0 40.0 39 36.21475 39.0 36.0 40.0 30.0 40.0 40 36.0565 39.0 35.0 40.0 30.0 40.0 41 36.0325 39.0 36.0 40.0 30.0 40.0 42 35.97825 39.0 35.0 40.0 30.0 40.0 43 35.944 39.0 36.0 40.0 30.0 40.0 44 35.72875 39.0 35.0 40.0 29.0 40.0 45 35.6335 38.0 35.0 39.0 29.0 40.0 46 35.56525 39.0 35.0 39.0 29.0 40.0 47 35.4945 38.0 35.0 39.0 30.0 40.0 48 35.36925 38.0 35.0 39.0 29.0 40.0 49 35.2035 38.0 35.0 39.0 28.0 40.0 50 35.04475 38.0 35.0 39.0 29.0 40.0 51 34.96325 38.0 35.0 39.0 29.0 40.0 52 34.7775 38.0 35.0 39.0 28.0 40.0 53 34.6205 38.0 34.0 39.0 28.0 40.0 54 34.466 38.0 34.0 39.0 27.0 40.0 55 34.20775 37.0 34.0 39.0 27.0 40.0 56 33.9595 37.0 34.0 39.0 26.0 40.0 57 33.751 37.0 33.0 39.0 25.0 39.0 58 33.5945 36.0 33.0 39.0 26.0 39.0 59 33.4975 36.0 33.0 39.0 25.0 39.0 60 33.2035 36.0 33.0 38.0 24.0 39.0 61 32.96675 36.0 33.0 38.0 23.0 39.0 62 32.75925 36.0 33.0 38.0 23.0 39.0 63 32.5275 36.0 33.0 38.0 22.0 39.0 64 32.412 36.0 33.0 38.0 22.0 39.0 65 32.23975 36.0 33.0 38.0 22.0 39.0 66 31.91725 36.0 32.0 38.0 18.0 39.0 67 31.68075 35.0 32.0 38.0 15.0 39.0 68 31.2385 35.0 31.0 38.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 1.0 6 2.0 7 2.0 8 7.0 9 10.0 10 8.0 11 6.0 12 9.0 13 11.0 14 12.0 15 6.0 16 4.0 17 13.0 18 14.0 19 13.0 20 11.0 21 16.0 22 15.0 23 21.0 24 22.0 25 25.0 26 30.0 27 31.0 28 33.0 29 53.0 30 55.0 31 65.0 32 86.0 33 104.0 34 160.0 35 217.0 36 340.0 37 560.0 38 1075.0 39 960.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.88944472236118 17.733866933466732 13.1815907953977 40.19509754877439 2 19.854963740935233 23.95598899724931 37.15928982245561 19.02975743935984 3 22.416812609457093 27.270452839629723 28.19614711033275 22.116587440580435 4 24.325 33.2 21.075 21.4 5 23.974999999999998 36.575 22.25 17.2 6 17.724999999999998 38.375 23.799999999999997 20.1 7 16.525000000000002 17.675 45.2 20.599999999999998 8 17.849999999999998 23.025000000000002 31.025000000000002 28.1 9 20.05 23.025000000000002 31.15 25.775 10 20.325 40.975 22.175 16.525000000000002 11 24.85 29.525000000000002 20.75 24.875 12 20.875 24.725 28.799999999999997 25.6 13 19.775000000000002 28.475 31.25 20.5 14 21.025 29.025000000000002 29.45 20.5 15 20.925 27.35 29.875 21.85 16 23.3 28.050000000000004 26.974999999999998 21.675 17 21.349999999999998 27.800000000000004 28.525 22.325 18 20.925 29.7 27.35 22.025 19 21.349999999999998 27.975 26.900000000000002 23.775 20 21.5 28.625 27.450000000000003 22.425 21 22.775000000000002 28.599999999999998 27.55 21.075 22 21.375 29.525000000000002 26.575 22.525000000000002 23 22.575 28.525 27.224999999999998 21.675 24 20.7 28.9 28.199999999999996 22.2 25 20.95 29.075 29.025000000000002 20.95 26 22.325 28.675 27.1 21.9 27 20.825 28.825 28.775000000000002 21.575 28 21.45 28.275 28.125 22.15 29 20.474999999999998 28.475 28.425 22.625 30 20.4 29.2 27.975 22.425 31 22.55 28.525 27.075 21.85 32 21.975 27.875 27.6 22.55 33 20.925 29.675 27.025 22.375 34 21.55 29.049999999999997 27.425 21.975 35 21.349999999999998 28.925 27.725 22.0 36 20.549999999999997 29.5 27.925 22.025 37 22.55 28.175 26.575 22.7 38 21.4 28.849999999999998 27.725 22.025 39 21.725 28.9 26.8 22.575 40 21.8 28.575 28.549999999999997 21.075 41 20.825 27.900000000000002 28.449999999999996 22.825 42 19.975 28.9 28.675 22.45 43 19.875 29.925 28.000000000000004 22.2 44 21.875 29.425 27.474999999999998 21.224999999999998 45 21.6 28.15 27.975 22.275 46 21.725 28.799999999999997 27.675 21.8 47 21.2 28.875 26.625 23.3 48 21.75 28.249999999999996 27.825 22.175 49 22.25 28.9 26.375 22.475 50 21.025 29.975 27.450000000000003 21.55 51 21.8 28.275 27.900000000000002 22.025 52 22.825 27.525 28.175 21.475 53 21.2 28.749999999999996 28.1 21.95 54 20.825 29.525000000000002 28.449999999999996 21.2 55 22.375 28.7 27.224999999999998 21.7 56 21.575 29.025000000000002 28.000000000000004 21.4 57 22.725 28.275 27.175 21.825 58 20.974999999999998 28.575 28.95 21.5 59 22.275 30.025000000000002 26.974999999999998 20.724999999999998 60 22.475 27.925 27.0 22.6 61 21.3 28.475 27.650000000000002 22.575 62 20.9 29.049999999999997 28.7 21.349999999999998 63 22.1 28.050000000000004 28.425 21.425 64 22.25 28.299999999999997 27.85 21.6 65 21.85 28.1 29.25 20.8 66 21.224999999999998 29.175 28.875 20.724999999999998 67 21.675 27.6 28.375 22.35 68 21.65 27.85 28.4 22.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 1.5 21 4.5 22 6.0 23 6.5 24 7.0 25 7.0 26 11.5 27 24.0 28 32.0 29 38.0 30 53.0 31 62.0 32 74.0 33 95.0 34 104.0 35 120.0 36 176.5 37 217.0 38 227.5 39 257.0 40 298.0 41 320.0 42 320.5 43 349.5 44 378.0 45 366.0 46 336.5 47 319.0 48 303.5 49 258.5 50 229.0 51 202.5 52 144.0 53 112.0 54 100.0 55 74.0 56 60.0 57 48.5 58 29.5 59 22.0 60 20.0 61 18.0 62 18.0 63 12.0 64 5.5 65 5.0 66 5.0 67 4.5 68 3.0 69 2.0 70 1.0 71 1.0 72 2.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8496993987976 99.65 2 0.125250501002004 0.25 3 0.0 0.0 4 0.0250501002004008 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra Read 318644 spots for SRR3207757.sra Written 318644 spots for SRR3207757.sra Read 318628 spots for SRR3207757.sra Written 318628 spots for SRR3207757.sra SRR ids: ['SRR3207757.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_it1q7hfs SRR3207757.sra spots: 6372576 blocks: [[1, 318628], [318629, 637256], [637257, 955884], [955885, 1274512], [1274513, 1593140], [1593141, 1911768], [1911769, 2230396], [2230397, 2549024], [2549025, 2867652], [2867653, 3186280], [3186281, 3504908], [3504909, 3823536], [3823537, 4142164], [4142165, 4460792], [4460793, 4779420], [4779421, 5098048], [5098049, 5416676], [5416677, 5735304], [5735305, 6053932], [6053933, 6372576]] SRR3207757 file size 1344203 SRR3207757 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207757 SRR3207757_1.fastq Input file: SRR3207757_1.fastq trimmed: SRR3207757-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 19:29:51 2025 >> started Mon Feb 10 19:29:54 2025 >> done (2.944s) 6372576 reads processed; of these: 18852 ( 0.30%) short reads filtered out after trimming by size control 25121 ( 0.39%) empty reads filtered out after trimming by size control 6328603 (99.31%) reads available; of these: 363112 ( 5.74%) trimmed reads available after processing 5965491 (94.26%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1068 0.02% 19 1689 0.03% 20 3075 0.05% 21 866 0.01% 22 1114 0.02% 23 1877 0.03% 24 3164 0.05% 25 6620 0.10% 26 1483 0.02% 27 1652 0.03% 28 2382 0.04% 29 3926 0.06% 30 7193 0.11% 31 1694 0.03% 32 2114 0.03% 33 2610 0.04% 34 4136 0.07% 35 7163 0.11% 36 1789 0.03% 37 2240 0.04% 38 3227 0.05% 39 5520 0.09% 40 9416 0.15% 41 2498 0.04% 42 2416 0.04% 43 3601 0.06% 44 6078 0.10% 45 10556 0.17% 46 2478 0.04% 47 3429 0.05% 48 4951 0.08% 49 8901 0.14% 50 16430 0.26% 51 3334 0.05% 52 4447 0.07% 53 6941 0.11% 54 11960 0.19% 55 24102 0.38% 56 4575 0.07% 57 6021 0.10% 58 9076 0.14% 59 16580 0.26% 60 37124 0.59% 61 5504 0.09% 62 7365 0.12% 63 11169 0.18% 64 19978 0.32% 65 37970 0.60% 66 5535 0.09% 67 14075 0.22% 68 5965491 94.26% 6328603 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=29 prefix-density=0.05 prefix-fanout=2.0 sequence=CATCAAGACCAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=139.79 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=18.0 sequence=TTCTTCTTCTTT Started job on | Feb 10 19:30:07 Started mapping on | Feb 10 19:30:07 Finished on | Feb 10 19:30:14 Mapping speed, Million of reads per hour | 3254.71 Number of input reads | 6328603 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 6047078 Uniquely mapped reads % | 95.55% Average mapped length | 67.02 Number of splices: Total | 1147508 Number of splices: Annotated (sjdb) | 1127298 Number of splices: GT/AG | 1130943 Number of splices: GC/AG | 13885 Number of splices: AT/AC | 1171 Number of splices: Non-canonical | 1509 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 185873 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 67599 % of reads mapped to too many loci | 1.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.43% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 95652 95652 95652 N_multimapping 185873 185873 185873 N_noFeature 322909 3153975 3177212 N_ambiguous 59117 9917 10476 UnstrandedReadsAssigned:5665052 PositiveStrandReadsAssigned:2883186 NegativeStrandReadsAssigned:2859390 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207757 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207757-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,328,603 reads, 5,832,998 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR3207757.ke.tsv 34699 SRR3207757.se.tsv 87100 total ==> SRR3207757.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 176 24.491 Potri.005G024800.1.v4.1 1035 936 26 7.41765 Potri.004G059700.1.v4.1 961 862 2 0.619572 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 99.3895 9.33211 Potri.016G087400.1.v4.1 270 171 206 321.692 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 18 2.87135 Potri.012G127500.1.v4.1 977 878 295 89.7214 ==> SRR3207757.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 970 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 108 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207757 completed mapping pipeline successfully