Starting /dee2/code/volunteer_pipeline.sh SRR3207758 current disk space = 3056616452096 free memory = 1574448168 SRR3207758 SRAfilesize 5544841b563c88025f3fcd03277cdab3 SRR3207758.sra SRR3207758.sra file validated SRR3207758 is single end SRR3207758 is conventional basespace SRR3207758 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207758_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.453 40.0 38.0 40.0 35.0 40.0 2 38.25775 40.0 38.0 40.0 35.0 40.0 3 38.28475 40.0 38.0 40.0 35.0 40.0 4 38.25025 39.0 38.0 40.0 35.0 40.0 5 38.2795 40.0 38.0 40.0 35.0 40.0 6 38.28325 39.0 38.0 40.0 35.0 40.0 7 38.2375 39.0 38.0 40.0 35.0 40.0 8 38.173 39.0 38.0 40.0 35.0 40.0 9 38.16125 40.0 38.0 40.0 35.0 40.0 10 38.09875 39.0 38.0 40.0 35.0 40.0 11 38.061 39.0 38.0 40.0 35.0 40.0 12 38.00475 39.0 38.0 40.0 35.0 40.0 13 37.911 39.0 38.0 40.0 34.0 40.0 14 37.96225 39.0 38.0 40.0 35.0 40.0 15 37.953 39.0 38.0 40.0 34.0 40.0 16 37.8885 39.0 38.0 40.0 34.0 40.0 17 37.74825 39.0 38.0 40.0 33.0 40.0 18 37.68225 39.0 38.0 40.0 33.0 40.0 19 37.73675 39.0 38.0 40.0 33.0 40.0 20 37.6415 39.0 38.0 40.0 33.0 40.0 21 37.56525 39.0 38.0 40.0 33.0 40.0 22 37.46825 39.0 38.0 40.0 33.0 40.0 23 37.417 39.0 38.0 40.0 33.0 40.0 24 37.35475 39.0 38.0 40.0 33.0 40.0 25 37.35425 39.0 37.0 40.0 33.0 40.0 26 37.27575 39.0 38.0 40.0 33.0 40.0 27 37.0415 39.0 37.0 40.0 33.0 40.0 28 37.0925 39.0 37.0 40.0 33.0 40.0 29 36.966 39.0 36.0 40.0 33.0 40.0 30 36.85125 39.0 36.0 40.0 32.0 40.0 31 36.75425 39.0 36.0 40.0 32.0 40.0 32 36.50075 39.0 36.0 40.0 31.0 40.0 33 36.54325 39.0 36.0 40.0 31.0 40.0 34 36.417 39.0 36.0 40.0 31.0 40.0 35 36.32075 39.0 36.0 40.0 30.0 40.0 36 36.4395 39.0 36.0 40.0 30.0 40.0 37 36.33725 39.0 36.0 40.0 30.0 40.0 38 36.33825 39.0 36.0 40.0 30.0 40.0 39 36.12675 39.0 36.0 40.0 30.0 40.0 40 35.97575 39.0 35.0 40.0 30.0 40.0 41 35.9525 39.0 36.0 40.0 30.0 40.0 42 35.88 39.0 36.0 40.0 30.0 40.0 43 35.841 39.0 35.0 40.0 30.0 40.0 44 35.5385 38.0 35.0 39.0 29.0 40.0 45 35.44425 38.0 35.0 39.0 29.0 40.0 46 35.529 38.0 35.0 39.0 30.0 40.0 47 35.356 38.0 35.0 39.0 29.0 40.0 48 35.2055 38.0 35.0 39.0 29.0 40.0 49 35.111 38.0 35.0 39.0 29.0 40.0 50 34.90525 38.0 35.0 39.0 29.0 40.0 51 34.75225 38.0 35.0 39.0 29.0 40.0 52 34.6065 38.0 34.0 39.0 29.0 40.0 53 34.41375 37.0 34.0 39.0 29.0 40.0 54 34.26225 37.0 34.0 39.0 27.0 39.0 55 34.12375 37.0 34.0 39.0 28.0 39.0 56 33.9155 37.0 33.0 39.0 28.0 39.0 57 33.652 36.0 33.0 39.0 26.0 39.0 58 33.439 36.0 33.0 38.0 26.0 39.0 59 33.18175 36.0 33.0 38.0 25.0 39.0 60 33.02925 36.0 33.0 38.0 25.0 39.0 61 32.71475 36.0 33.0 38.0 23.0 39.0 62 32.48875 36.0 33.0 38.0 23.0 39.0 63 32.24725 36.0 33.0 38.0 23.0 39.0 64 32.10625 35.0 32.0 38.0 23.0 39.0 65 31.7985 35.0 32.0 38.0 20.0 39.0 66 31.54625 35.0 32.0 38.0 17.0 39.0 67 31.2955 35.0 31.0 37.0 15.0 39.0 68 30.8935 35.0 31.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 1.0 5 1.0 6 3.0 7 3.0 8 1.0 9 5.0 10 11.0 11 4.0 12 12.0 13 8.0 14 12.0 15 10.0 16 10.0 17 11.0 18 17.0 19 13.0 20 14.0 21 16.0 22 13.0 23 21.0 24 23.0 25 20.0 26 26.0 27 19.0 28 35.0 29 47.0 30 66.0 31 64.0 32 79.0 33 129.0 34 150.0 35 247.0 36 392.0 37 587.0 38 1135.0 39 790.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.507126781695426 15.228807201800452 13.828457114278569 42.43560890222556 2 21.68584292146073 22.511255627813906 35.74287143571786 20.060030015007506 3 22.475 26.8 25.95 24.775 4 24.85 32.225 21.224999999999998 21.7 5 24.95 35.6 21.75 17.7 6 18.525 37.824999999999996 23.849999999999998 19.8 7 17.154288572143038 18.229557389347338 44.06101525381345 20.555138784696176 8 18.3 23.825 29.599999999999998 28.275 9 20.375 23.225 32.225 24.175 10 20.4 39.15 23.175 17.275 11 25.874999999999996 29.225 21.425 23.474999999999998 12 20.925 25.1 30.25 23.724999999999998 13 20.549999999999997 28.299999999999997 30.7 20.45 14 21.05 27.975 28.025 22.95 15 19.950000000000003 29.125 28.15 22.775000000000002 16 21.825 26.650000000000002 28.825 22.7 17 21.325 29.299999999999997 26.575 22.8 18 21.025 28.65 28.275 22.05 19 22.1 28.425 27.250000000000004 22.225 20 23.125 28.225 26.6 22.05 21 21.45 28.1 27.55 22.900000000000002 22 20.45 28.249999999999996 28.675 22.625 23 21.325 28.625 28.4 21.65 24 21.5 29.15 27.35 22.0 25 22.475 28.275 25.85 23.400000000000002 26 21.575 28.175 27.075 23.175 27 22.630657664416105 27.68192048012003 27.7569392348087 21.930482620655166 28 22.900000000000002 26.875 27.750000000000004 22.475 29 21.80545136284071 27.85696424106027 28.157039259814955 22.18054513628407 30 22.1055263815954 27.85696424106027 26.93173293323331 23.10577644411103 31 21.775 27.625 27.275 23.325000000000003 32 21.625 28.625 26.125 23.625 33 21.2 29.099999999999998 27.450000000000003 22.25 34 21.375 29.475 27.650000000000002 21.5 35 22.375 27.950000000000003 27.250000000000004 22.425 36 21.2 28.799999999999997 27.55 22.45 37 22.975 27.125 27.575 22.325 38 22.0 29.65 27.450000000000003 20.9 39 22.275 27.825 26.950000000000003 22.95 40 23.125 26.825 26.875 23.175 41 21.9 29.675 26.575 21.85 42 21.625 27.650000000000002 27.950000000000003 22.775000000000002 43 22.650000000000002 27.200000000000003 28.325 21.825 44 21.825 28.449999999999996 28.299999999999997 21.425 45 22.15 27.675 27.85 22.325 46 22.0 27.875 28.050000000000004 22.075 47 22.975 28.199999999999996 27.375 21.45 48 21.9 27.525 27.950000000000003 22.625 49 20.150000000000002 28.4 28.749999999999996 22.7 50 22.175 28.95 27.375 21.5 51 22.0 27.85 28.000000000000004 22.15 52 22.775000000000002 27.750000000000004 27.55 21.925 53 21.275 27.400000000000002 28.125 23.200000000000003 54 21.775 28.7 27.875 21.65 55 22.525000000000002 26.674999999999997 27.500000000000004 23.3 56 22.15 27.1 28.525 22.225 57 22.15 27.725 28.449999999999996 21.675 58 21.675 28.749999999999996 27.55 22.025 59 23.45 27.0 27.275 22.275 60 22.35 28.075 27.325 22.25 61 22.175 28.15 27.55 22.125 62 22.125 29.275000000000002 27.375 21.224999999999998 63 23.45 27.150000000000002 27.500000000000004 21.9 64 22.675 27.525 28.075 21.725 65 21.7 28.499999999999996 27.375 22.425 66 23.0 27.650000000000002 27.900000000000002 21.45 67 21.925 27.35 27.925 22.8 68 22.275 27.950000000000003 27.200000000000003 22.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 1.5 21 4.0 22 5.0 23 4.5 24 5.5 25 7.0 26 6.0 27 11.0 28 17.0 29 20.5 30 28.5 31 33.0 32 48.0 33 67.5 34 72.0 35 92.5 36 153.5 37 194.0 38 193.5 39 240.5 40 309.5 41 331.0 42 343.0 43 393.5 44 432.0 45 396.5 46 340.0 47 319.0 48 300.5 49 273.5 50 265.0 51 219.0 52 155.5 53 138.0 54 119.5 55 89.0 56 77.0 57 67.5 58 45.5 59 33.0 60 24.5 61 14.5 62 13.0 63 8.5 64 3.5 65 5.0 66 7.0 67 3.5 68 1.5 69 3.0 70 2.5 71 1.5 72 1.0 73 1.0 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.0 29 0.025 30 0.025 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Read 445068 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Written 445068 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra Read 445066 spots for SRR3207758.sra Written 445066 spots for SRR3207758.sra SRR ids: ['SRR3207758.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lit64u43 SRR3207758.sra spots: 8901322 blocks: [[1, 445066], [445067, 890132], [890133, 1335198], [1335199, 1780264], [1780265, 2225330], [2225331, 2670396], [2670397, 3115462], [3115463, 3560528], [3560529, 4005594], [4005595, 4450660], [4450661, 4895726], [4895727, 5340792], [5340793, 5785858], [5785859, 6230924], [6230925, 6675990], [6675991, 7121056], [7121057, 7566122], [7566123, 8011188], [8011189, 8456254], [8456255, 8901322]] SRR3207758 file size 1878020 SRR3207758 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207758 SRR3207758_1.fastq Input file: SRR3207758_1.fastq trimmed: SRR3207758-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:04:13 2025 >> started Mon Feb 10 21:04:17 2025 >> done (4.104s) 8901322 reads processed; of these: 23846 ( 0.27%) short reads filtered out after trimming by size control 17015 ( 0.19%) empty reads filtered out after trimming by size control 8860461 (99.54%) reads available; of these: 536462 ( 6.05%) trimmed reads available after processing 8323999 (93.95%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1480 0.02% 19 2311 0.03% 20 4344 0.05% 21 1254 0.01% 22 1798 0.02% 23 2709 0.03% 24 4629 0.05% 25 9674 0.11% 26 2065 0.02% 27 2543 0.03% 28 3562 0.04% 29 5717 0.06% 30 10318 0.12% 31 2443 0.03% 32 3160 0.04% 33 3743 0.04% 34 5955 0.07% 35 10608 0.12% 36 2594 0.03% 37 3342 0.04% 38 4775 0.05% 39 7900 0.09% 40 13819 0.16% 41 3508 0.04% 42 3485 0.04% 43 5125 0.06% 44 8638 0.10% 45 15543 0.18% 46 3456 0.04% 47 5029 0.06% 48 7534 0.09% 49 13284 0.15% 50 24507 0.28% 51 4949 0.06% 52 6635 0.07% 53 10378 0.12% 54 18276 0.21% 55 35949 0.41% 56 6733 0.08% 57 8695 0.10% 58 13669 0.15% 59 24623 0.28% 60 54932 0.62% 61 8411 0.09% 62 10789 0.12% 63 16426 0.19% 64 29792 0.34% 65 56253 0.63% 66 8167 0.09% 67 20933 0.24% 68 8323999 93.95% 8860461 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=40 prefix-density=0.04 prefix-fanout=1.9 sequence=CCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=10 fanout-score=183.12 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=20.6 sequence=TTCTTCTTCTTT Started job on | Feb 10 21:04:32 Started mapping on | Feb 10 21:04:32 Finished on | Feb 10 21:04:40 Mapping speed, Million of reads per hour | 3987.21 Number of input reads | 8860461 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 8470080 Uniquely mapped reads % | 95.59% Average mapped length | 67.01 Number of splices: Total | 1709532 Number of splices: Annotated (sjdb) | 1681917 Number of splices: GT/AG | 1684942 Number of splices: GC/AG | 21005 Number of splices: AT/AC | 1768 Number of splices: Non-canonical | 1817 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.78 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271187 % of reads mapped to multiple loci | 3.06% Number of reads mapped to too many loci | 96745 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.22% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 119194 119194 119194 N_multimapping 271187 271187 271187 N_noFeature 306219 4325711 4399473 N_ambiguous 75216 11818 12370 UnstrandedReadsAssigned:8088645 PositiveStrandReadsAssigned:4132551 NegativeStrandReadsAssigned:4058237 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207758 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207758-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,860,461 reads, 8,329,513 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52401 SRR3207758.ke.tsv 34699 SRR3207758.se.tsv 87100 total ==> SRR3207758.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 251 23.1181 Potri.005G024800.1.v4.1 1035 936 28 5.28732 Potri.004G059700.1.v4.1 961 862 6 1.23026 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 116.59 7.24576 Potri.016G087400.1.v4.1 270 171 299 309.05 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 31.599 3.33635 Potri.012G127500.1.v4.1 977 878 1251 251.835 ==> SRR3207758.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1073 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 171 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207758 completed mapping pipeline successfully