Starting /dee2/code/volunteer_pipeline.sh SRR3207759 current disk space = 3056543363072 free memory = 1441145336 SRR3207759 SRAfilesize 3cbbc8a9696bcf18889cf8e3fe63af93 SRR3207759.sra SRR3207759.sra file validated SRR3207759 is single end SRR3207759 is conventional basespace SRR3207759 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207759_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.3395 40.0 38.0 40.0 35.0 40.0 2 38.08775 39.0 38.0 40.0 35.0 40.0 3 38.09 39.0 38.0 40.0 35.0 40.0 4 38.0325 39.0 38.0 40.0 34.0 40.0 5 38.09225 39.0 38.0 40.0 35.0 40.0 6 38.09125 39.0 38.0 40.0 35.0 40.0 7 38.0175 39.0 38.0 40.0 35.0 40.0 8 37.9885 39.0 38.0 40.0 35.0 40.0 9 37.97625 39.0 38.0 40.0 34.0 40.0 10 37.87475 39.0 38.0 40.0 33.0 40.0 11 37.92675 39.0 38.0 40.0 34.0 40.0 12 37.8325 39.0 38.0 40.0 34.0 40.0 13 37.76375 39.0 38.0 40.0 33.0 40.0 14 37.76425 39.0 38.0 40.0 33.0 40.0 15 37.71025 39.0 38.0 40.0 33.0 40.0 16 37.664 39.0 38.0 40.0 33.0 40.0 17 37.4605 39.0 38.0 40.0 33.0 40.0 18 37.472 39.0 38.0 40.0 33.0 40.0 19 37.44275 39.0 38.0 40.0 33.0 40.0 20 37.345 39.0 38.0 40.0 33.0 40.0 21 37.32075 39.0 38.0 40.0 33.0 40.0 22 37.05125 39.0 37.0 40.0 32.0 40.0 23 37.1595 39.0 37.0 40.0 32.0 40.0 24 36.953 39.0 36.0 40.0 31.0 40.0 25 36.955 39.0 37.0 40.0 31.0 40.0 26 36.669 39.0 36.0 40.0 31.0 40.0 27 36.5715 39.0 36.0 40.0 30.0 40.0 28 36.50375 39.0 36.0 40.0 30.0 40.0 29 36.41225 39.0 36.0 40.0 30.0 40.0 30 36.33525 39.0 36.0 40.0 30.0 40.0 31 36.424 39.0 36.0 40.0 31.0 40.0 32 36.23625 39.0 35.0 40.0 30.0 40.0 33 36.292 39.0 36.0 40.0 30.0 40.0 34 36.1355 39.0 35.0 40.0 30.0 40.0 35 36.065 39.0 35.0 40.0 30.0 40.0 36 36.14025 39.0 36.0 40.0 30.0 40.0 37 35.94875 39.0 35.0 40.0 30.0 40.0 38 35.9845 39.0 35.0 40.0 30.0 40.0 39 35.6775 38.0 35.0 40.0 29.0 40.0 40 35.65275 38.0 35.0 40.0 29.0 40.0 41 35.5375 38.0 35.0 40.0 29.0 40.0 42 35.432 38.0 35.0 39.0 29.0 40.0 43 35.3145 38.0 35.0 39.0 29.0 40.0 44 35.18525 38.0 35.0 39.0 29.0 40.0 45 35.0295 38.0 35.0 39.0 28.0 40.0 46 35.07275 38.0 35.0 39.0 29.0 40.0 47 34.9515 38.0 35.0 39.0 28.0 40.0 48 34.70225 38.0 34.0 39.0 28.0 40.0 49 34.60875 38.0 34.0 39.0 28.0 40.0 50 34.357 38.0 34.0 39.0 27.0 40.0 51 34.14525 37.0 34.0 39.0 27.0 40.0 52 34.011 37.0 33.0 39.0 26.0 39.0 53 33.79125 37.0 33.0 39.0 25.0 39.0 54 33.5305 36.0 33.0 39.0 25.0 39.0 55 33.43925 36.0 33.0 38.0 25.0 39.0 56 33.253 36.0 33.0 39.0 24.0 39.0 57 32.9 36.0 33.0 38.0 23.0 39.0 58 32.7845 36.0 33.0 38.0 23.0 39.0 59 32.58775 36.0 32.0 38.0 23.0 39.0 60 32.3045 36.0 32.0 38.0 22.0 39.0 61 31.83725 36.0 32.0 38.0 16.0 39.0 62 31.61325 35.0 32.0 38.0 17.0 39.0 63 31.37575 35.0 31.0 38.0 13.0 39.0 64 31.22975 35.0 31.0 38.0 7.0 39.0 65 30.8985 35.0 31.0 37.0 2.0 38.0 66 30.7745 35.0 31.0 37.0 2.0 38.0 67 30.51925 35.0 31.0 36.0 2.0 38.0 68 30.00125 34.0 30.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 1.0 5 2.0 6 1.0 7 1.0 8 3.0 9 7.0 10 12.0 11 6.0 12 6.0 13 11.0 14 14.0 15 10.0 16 13.0 17 14.0 18 10.0 19 9.0 20 23.0 21 23.0 22 26.0 23 28.0 24 23.0 25 29.0 26 25.0 27 30.0 28 59.0 29 54.0 30 78.0 31 97.0 32 88.0 33 135.0 34 183.0 35 241.0 36 336.0 37 599.0 38 1114.0 39 681.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.806951737934483 14.87871967991998 14.853713428357091 42.460615153788446 2 22.94794794794795 21.62162162162162 33.33333333333333 22.097097097097095 3 21.930482620655166 23.55588897224306 28.907226806701676 25.6064016004001 4 24.825 31.15 20.549999999999997 23.474999999999998 5 27.750000000000004 31.35 22.900000000000002 18.0 6 22.575 35.725 23.0 18.7 7 16.804201050262566 20.580145036259065 41.28532133033258 21.330332583145786 8 18.8 25.3 29.375 26.525 9 22.45 22.225 32.025 23.3 10 19.425 37.4 26.400000000000002 16.775000000000002 11 24.3 29.5 21.95 24.25 12 21.075 23.1 29.775000000000002 26.05 13 20.025000000000002 29.75 30.3 19.925 14 20.525 26.700000000000003 29.775000000000002 23.0 15 21.725 27.800000000000004 28.725 21.75 16 23.625 26.400000000000002 27.700000000000003 22.275 17 22.925 27.3 26.875 22.900000000000002 18 21.224999999999998 27.625 30.175 20.974999999999998 19 21.525 27.375 29.425 21.675 20 22.6 27.0 29.349999999999998 21.05 21 23.474999999999998 27.474999999999998 27.150000000000002 21.9 22 23.075000000000003 28.325 26.650000000000002 21.95 23 22.325 29.775000000000002 27.3 20.599999999999998 24 22.6 28.025 27.55 21.825 25 21.875 27.474999999999998 27.825 22.825 26 23.225 26.625 27.450000000000003 22.7 27 22.9057264316079 27.781945486371594 26.206551637909474 23.10577644411103 28 21.680420105026258 29.9074768692173 27.131782945736433 21.280320080020005 29 23.080770192548137 29.08227056764191 25.63140785196299 22.20555138784696 30 22.155538884721178 27.53188297074269 28.132033008252062 22.18054513628407 31 20.925 28.575 28.075 22.425 32 22.6 28.175 27.224999999999998 22.0 33 22.325 27.575 25.924999999999997 24.175 34 23.599999999999998 28.299999999999997 27.3 20.8 35 22.75 28.95 25.85 22.45 36 21.275 30.349999999999998 28.000000000000004 20.375 37 20.974999999999998 27.6 27.950000000000003 23.474999999999998 38 25.2 27.575 26.424999999999997 20.8 39 22.0 27.875 28.625 21.5 40 22.0 28.299999999999997 26.25 23.45 41 21.95 26.950000000000003 29.599999999999998 21.5 42 21.775 28.675 26.650000000000002 22.900000000000002 43 22.05 28.4 27.85 21.7 44 21.075 28.775000000000002 27.025 23.125 45 23.0 27.175 26.6 23.225 46 21.7 27.425 28.625 22.25 47 22.2 28.825 25.474999999999998 23.5 48 21.975 27.775 27.425 22.825 49 22.475 29.175 27.1 21.25 50 23.425 26.450000000000003 27.3 22.825 51 22.650000000000002 27.35 27.425 22.575 52 22.2 27.05 27.400000000000002 23.35 53 21.3 28.625 28.075 22.0 54 21.425 27.450000000000003 26.900000000000002 24.224999999999998 55 22.650000000000002 27.6 28.325 21.425 56 21.7 28.7 28.000000000000004 21.6 57 22.175 26.75 28.225 22.85 58 21.5 27.725 27.3 23.474999999999998 59 23.95 29.775000000000002 26.400000000000002 19.875 60 23.400000000000002 27.200000000000003 26.900000000000002 22.5 61 21.75 28.375 28.050000000000004 21.825 62 22.3 26.825 29.025000000000002 21.85 63 21.349999999999998 27.750000000000004 28.499999999999996 22.400000000000002 64 22.175 27.425 28.175 22.225 65 21.175 27.85 26.974999999999998 24.0 66 22.825 26.900000000000002 27.400000000000002 22.875 67 21.875 28.4 27.825 21.9 68 22.125 29.425 27.400000000000002 21.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.5 2 1.5 3 1.0 4 0.5 5 0.5 6 1.0 7 1.5 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 1.0 17 0.5 18 1.0 19 2.0 20 2.0 21 2.5 22 3.0 23 4.5 24 7.5 25 9.0 26 9.5 27 12.0 28 14.0 29 16.5 30 26.5 31 34.0 32 43.5 33 69.0 34 85.0 35 101.0 36 140.0 37 163.0 38 171.0 39 218.5 40 281.0 41 304.0 42 336.0 43 364.5 44 361.0 45 356.5 46 358.0 47 364.0 48 342.5 49 277.0 50 233.0 51 238.0 52 203.5 53 164.0 54 132.5 55 81.5 56 62.0 57 53.0 58 39.5 59 35.0 60 30.5 61 20.5 62 15.0 63 13.5 64 9.0 65 6.0 66 6.0 67 5.0 68 3.5 69 3.0 70 2.0 71 1.5 72 2.0 73 2.5 74 2.5 75 2.0 76 1.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.1 3 0.025 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.025 29 0.025 30 0.025 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.56521739130434 97.32499999999999 2 0.3069053708439898 0.6 3 0.025575447570332477 0.075 4 0.051150895140664954 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051150895140664954 1.7999999999999998 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source CGTATGCCGTCTTCTGCTTGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTA 46 1.15 TruSeq Adapter, Index 9 (100% over 47bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTGAAAAA 26 0.65 TruSeq Adapter, Index 9 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10 0.1 0.0 0.0 0.0 0.0 11 0.1 0.0 0.0 0.0 0.0 12 0.1 0.0 0.0 0.0 0.0 13 0.1 0.0 0.0 0.0 0.0 14 0.1 0.0 0.0 0.0 0.0 15 0.1 0.0 0.0 0.0 0.0 16 0.1 0.0 0.0 0.0 0.0 17 0.1 0.0 0.0 0.0 0.0 18 0.1 0.0 0.0 0.0 0.0 19 0.1 0.0 0.0 0.0 0.0 20 0.1 0.0 0.0 0.0 0.0 21 1.4 0.0 0.0 0.0 0.0 22 1.425 0.0 0.0 0.0 0.0 23 1.475 0.0 0.0 0.0 0.0 24 1.475 0.0 0.0 0.0 0.0 25 1.475 0.0 0.0 0.0 0.0 26 1.475 0.0 0.0 0.0 0.0 27 1.475 0.0 0.0 0.0 0.0 28 1.475 0.0 0.0 0.0 0.0 29 1.475 0.0 0.0 0.0 0.0 30 1.475 0.0 0.0 0.0 0.0 31 1.475 0.0 0.0 0.0 0.0 32 1.475 0.0 0.0 0.0 0.0 33 1.475 0.0 0.0 0.0 0.0 34 1.475 0.0 0.0 0.0 0.0 35 1.475 0.0 0.0 0.0 0.0 36 1.475 0.0 0.0 0.0 0.0 37 1.475 0.0 0.0 0.0 0.0 38 1.475 0.0 0.0 0.0 0.0 39 1.475 0.0 0.0 0.0 0.0 40 1.475 0.0 0.0 0.0 0.0 41 1.475 0.0 0.0 0.0 0.0 42 1.475 0.0 0.0 0.0 0.0 43 1.475 0.0 0.0 0.0 0.0 44 1.475 0.0 0.0 0.0 0.0 45 1.475 0.0 0.0 0.0 0.0 46 1.475 0.0 0.0 0.0 0.0 47 1.475 0.0 0.0 0.0 0.0 48 1.475 0.0 0.0 0.0 0.0 49 1.475 0.0 0.0 0.0 0.0 50 1.475 0.0 0.0 0.0 0.0 51 1.475 0.0 0.0 0.0 0.0 52 1.475 0.0 0.0 0.0 0.0 53 1.475 0.0 0.0 0.0 0.0 54 1.475 0.0 0.0 0.0 0.0 55 1.475 0.0 0.0 0.0 0.0 56 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578767 spots for SRR3207759.sra Written 578767 spots for SRR3207759.sra Read 578773 spots for SRR3207759.sra Written 578773 spots for SRR3207759.sra SRR ids: ['SRR3207759.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6676giow SRR3207759.sra spots: 11575346 blocks: [[1, 578767], [578768, 1157534], [1157535, 1736301], [1736302, 2315068], [2315069, 2893835], [2893836, 3472602], [3472603, 4051369], [4051370, 4630136], [4630137, 5208903], [5208904, 5787670], [5787671, 6366437], [6366438, 6945204], [6945205, 7523971], [7523972, 8102738], [8102739, 8681505], [8681506, 9260272], [9260273, 9839039], [9839040, 10417806], [10417807, 10996573], [10996574, 11575346]] SRR3207759 file size 2444073 SRR3207759 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207759 SRR3207759_1.fastq Input file: SRR3207759_1.fastq trimmed: SRR3207759-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 19:40:26 2025 >> started Mon Feb 10 19:40:33 2025 >> done (6.749s) 11575346 reads processed; of these: 38823 ( 0.34%) short reads filtered out after trimming by size control 216393 ( 1.87%) empty reads filtered out after trimming by size control 11320130 (97.80%) reads available; of these: 859372 ( 7.59%) trimmed reads available after processing 10460758 (92.41%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2715 0.02% 19 6207 0.05% 20 120796 1.07% 21 3136 0.03% 22 4297 0.04% 23 4509 0.04% 24 7385 0.07% 25 15014 0.13% 26 3269 0.03% 27 3702 0.03% 28 5211 0.05% 29 8165 0.07% 30 15284 0.14% 31 3682 0.03% 32 4641 0.04% 33 5837 0.05% 34 8810 0.08% 35 15644 0.14% 36 3755 0.03% 37 4733 0.04% 38 6884 0.06% 39 11127 0.10% 40 19951 0.18% 41 5045 0.04% 42 5033 0.04% 43 7411 0.07% 44 12182 0.11% 45 21682 0.19% 46 5122 0.05% 47 6760 0.06% 48 10290 0.09% 49 18252 0.16% 50 33517 0.30% 51 6806 0.06% 52 9215 0.08% 53 13966 0.12% 54 24373 0.22% 55 47828 0.42% 56 9154 0.08% 57 11963 0.11% 58 18133 0.16% 59 33447 0.30% 60 73120 0.65% 61 11377 0.10% 62 14960 0.13% 63 22351 0.20% 64 39939 0.35% 65 74444 0.66% 66 10994 0.10% 67 27254 0.24% 68 10460758 92.41% 11320130 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=40 prefix-density=0.00 prefix-fanout=1.0 sequence=CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAATG criterion=fanout-score sequence-density=0.04 sequence-density-rank=10 fanout-score=189.86 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=22.0 sequence=TTCTTCTTCTTC Started job on | Feb 10 19:41:00 Started mapping on | Feb 10 19:41:01 Finished on | Feb 10 19:41:12 Mapping speed, Million of reads per hour | 3704.77 Number of input reads | 11320130 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 10587756 Uniquely mapped reads % | 93.53% Average mapped length | 66.93 Number of splices: Total | 2056803 Number of splices: Annotated (sjdb) | 2022360 Number of splices: GT/AG | 2027095 Number of splices: GC/AG | 25346 Number of splices: AT/AC | 2169 Number of splices: Non-canonical | 2193 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.85 Insertion rate per base | 0.01% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 467280 % of reads mapped to multiple loci | 4.13% Number of reads mapped to too many loci | 198048 % of reads mapped to too many loci | 1.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 265094 265094 265094 N_multimapping 467280 467280 467280 N_noFeature 406346 5408166 5509960 N_ambiguous 107778 15601 16293 UnstrandedReadsAssigned:10073632 PositiveStrandReadsAssigned:5163989 NegativeStrandReadsAssigned:5061503 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207759 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207759-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,320,130 reads, 10,446,303 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR3207759.ke.tsv 34699 SRR3207759.se.tsv 87100 total ==> SRR3207759.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 372 27.5846 Potri.005G024800.1.v4.1 1035 936 45 6.84124 Potri.004G059700.1.v4.1 961 862 11 1.81587 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 148.692 7.4397 Potri.016G087400.1.v4.1 270 171 445 370.307 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 46.7544 3.97434 Potri.012G127500.1.v4.1 977 878 1139 184.598 ==> SRR3207759.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1635 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 198 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 29 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207759 completed mapping pipeline successfully