Starting /dee2/code/volunteer_pipeline.sh SRR3207760 current disk space = 3056071974912 free memory = 1491623700 SRR3207760 SRAfilesize be4f921027b9d4c053487a6ff43f39fe SRR3207760.sra SRR3207760.sra file validated SRR3207760 is single end SRR3207760 is conventional basespace SRR3207760 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207760_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.47925 40.0 38.0 40.0 35.0 40.0 2 38.2625 40.0 38.0 40.0 35.0 40.0 3 38.23625 40.0 38.0 40.0 35.0 40.0 4 38.2265 40.0 38.0 40.0 35.0 40.0 5 38.26175 40.0 38.0 40.0 35.0 40.0 6 38.255 40.0 38.0 40.0 35.0 40.0 7 38.22625 40.0 38.0 40.0 35.0 40.0 8 38.13975 40.0 38.0 40.0 35.0 40.0 9 38.0885 39.0 38.0 40.0 35.0 40.0 10 38.08375 40.0 38.0 40.0 35.0 40.0 11 38.0655 39.0 38.0 40.0 35.0 40.0 12 38.00625 39.0 38.0 40.0 35.0 40.0 13 37.931 39.0 38.0 40.0 33.0 40.0 14 37.99475 39.0 38.0 40.0 33.0 40.0 15 37.89725 39.0 38.0 40.0 33.0 40.0 16 37.95775 39.0 38.0 40.0 35.0 40.0 17 37.81325 39.0 38.0 40.0 33.0 40.0 18 37.79325 39.0 38.0 40.0 33.0 40.0 19 37.79875 39.0 38.0 40.0 33.0 40.0 20 37.699 39.0 38.0 40.0 33.0 40.0 21 37.554 39.0 38.0 40.0 33.0 40.0 22 37.49025 39.0 38.0 40.0 33.0 40.0 23 37.4575 39.0 38.0 40.0 33.0 40.0 24 37.5185 39.0 38.0 40.0 33.0 40.0 25 37.2925 39.0 37.0 40.0 33.0 40.0 26 37.349 39.0 38.0 40.0 33.0 40.0 27 37.31475 39.0 38.0 40.0 33.0 40.0 28 37.1315 39.0 37.0 40.0 33.0 40.0 29 37.051 39.0 37.0 40.0 32.0 40.0 30 36.964 39.0 36.0 40.0 32.0 40.0 31 36.9295 39.0 36.0 40.0 32.0 40.0 32 36.70775 39.0 36.0 40.0 31.0 40.0 33 36.8025 39.0 36.0 40.0 32.0 40.0 34 36.71675 39.0 36.0 40.0 31.0 40.0 35 36.58825 39.0 36.0 40.0 31.0 40.0 36 36.6705 39.0 36.0 40.0 31.0 40.0 37 36.55475 39.0 36.0 40.0 31.0 40.0 38 36.5585 39.0 36.0 40.0 31.0 40.0 39 36.368 39.0 36.0 40.0 31.0 40.0 40 36.2165 39.0 36.0 40.0 30.0 40.0 41 36.23275 39.0 36.0 40.0 30.0 40.0 42 36.2055 39.0 36.0 40.0 30.0 40.0 43 36.07825 39.0 36.0 40.0 30.0 40.0 44 35.97175 39.0 35.0 40.0 30.0 40.0 45 35.8445 38.0 35.0 39.0 30.0 40.0 46 35.9545 39.0 36.0 40.0 30.0 40.0 47 35.8165 38.0 35.0 39.0 30.0 40.0 48 35.681 38.0 35.0 39.0 30.0 40.0 49 35.539 38.0 35.0 39.0 30.0 40.0 50 35.28825 38.0 35.0 39.0 29.0 40.0 51 35.09875 38.0 35.0 39.0 29.0 40.0 52 34.9625 38.0 35.0 39.0 29.0 40.0 53 34.758 38.0 34.0 39.0 28.0 40.0 54 34.5915 38.0 34.0 39.0 28.0 40.0 55 34.3675 37.0 34.0 39.0 27.0 40.0 56 34.18875 38.0 34.0 39.0 27.0 40.0 57 33.9405 37.0 33.0 39.0 27.0 39.0 58 33.8095 36.0 33.0 39.0 26.0 39.0 59 33.65075 36.0 33.0 39.0 26.0 39.0 60 33.384 36.0 33.0 38.0 25.0 39.0 61 33.1095 36.0 33.0 38.0 24.0 39.0 62 32.8135 36.0 33.0 38.0 23.0 39.0 63 32.7265 36.0 33.0 38.0 23.0 39.0 64 32.63525 36.0 33.0 38.0 23.0 39.0 65 32.33375 36.0 33.0 38.0 23.0 39.0 66 32.00925 36.0 32.0 38.0 20.0 39.0 67 31.88625 35.0 32.0 38.0 20.0 39.0 68 31.459 35.0 31.0 38.0 17.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 0.0 5 0.0 6 3.0 7 2.0 8 1.0 9 5.0 10 1.0 11 6.0 12 11.0 13 8.0 14 4.0 15 8.0 16 14.0 17 6.0 18 13.0 19 13.0 20 14.0 21 18.0 22 15.0 23 23.0 24 14.0 25 19.0 26 37.0 27 38.0 28 37.0 29 51.0 30 59.0 31 67.0 32 98.0 33 104.0 34 125.0 35 240.0 36 321.0 37 549.0 38 1099.0 39 972.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.664832416208103 15.157578789394696 15.182591295647823 39.99499749874937 2 20.555138784696176 22.155538884721178 35.65891472868217 21.630407601900476 3 23.25 26.224999999999998 26.05 24.474999999999998 4 25.650000000000002 32.525 19.900000000000002 21.925 5 25.474999999999998 35.075 21.775 17.675 6 19.15 38.175 23.325000000000003 19.35 7 17.599999999999998 18.224999999999998 44.074999999999996 20.1 8 19.375 24.525 29.7 26.400000000000002 9 18.6 24.275 31.374999999999996 25.75 10 18.45 38.925 25.25 17.375 11 25.275 28.95 22.975 22.8 12 21.25 25.25 29.45 24.05 13 20.45 28.4 30.675 20.474999999999998 14 21.05 28.325 28.875 21.75 15 21.65 28.000000000000004 28.925 21.425 16 21.45 28.999999999999996 27.825 21.725 17 22.650000000000002 27.750000000000004 28.325 21.275 18 20.549999999999997 28.549999999999997 28.799999999999997 22.1 19 22.575 28.775000000000002 27.025 21.625 20 22.75 27.950000000000003 26.575 22.725 21 20.875 28.725 27.875 22.525000000000002 22 22.35 28.375 26.700000000000003 22.575 23 21.55 28.275 28.15 22.025 24 21.349999999999998 28.849999999999998 28.000000000000004 21.8 25 23.075000000000003 28.075 27.55 21.3 26 22.875 28.425 27.650000000000002 21.05 27 21.630407601900476 28.40710177544386 27.481870467616904 22.48062015503876 28 23.425 28.175 27.075 21.325 29 21.880470117529384 28.032008002000502 28.782195548887223 21.305326331582897 30 20.605151287821954 27.35683920980245 28.28207051762941 23.755938984746187 31 21.85 27.625 28.499999999999996 22.025 32 22.825 28.125 28.275 20.775 33 22.775000000000002 26.75 28.299999999999997 22.175 34 22.35 27.675 28.15 21.825 35 22.975 27.3 28.15 21.575 36 21.3 28.749999999999996 28.225 21.725 37 22.6 28.4 27.725 21.275 38 22.1 28.050000000000004 26.950000000000003 22.900000000000002 39 22.8 27.950000000000003 27.55 21.7 40 21.875 28.249999999999996 28.249999999999996 21.625 41 21.575 28.975 26.950000000000003 22.5 42 21.4 26.974999999999998 28.975 22.650000000000002 43 21.025 28.999999999999996 28.599999999999998 21.375 44 21.775 27.575 28.075 22.575 45 20.95 28.9 28.449999999999996 21.7 46 21.95 27.450000000000003 28.95 21.65 47 21.5 29.475 27.425 21.6 48 21.95 27.925 27.525 22.6 49 22.1 27.075 28.999999999999996 21.825 50 20.95 28.65 28.849999999999998 21.55 51 21.5 26.275 29.049999999999997 23.175 52 21.475 28.9 28.025 21.6 53 21.925 28.199999999999996 27.200000000000003 22.675 54 21.25 27.575 28.725 22.45 55 21.6 28.65 27.625 22.125 56 21.75 27.400000000000002 28.749999999999996 22.1 57 21.775 27.875 28.275 22.075 58 23.275000000000002 27.175 29.049999999999997 20.5 59 21.725 28.299999999999997 27.450000000000003 22.525000000000002 60 22.525000000000002 27.975 27.675 21.825 61 21.85 28.599999999999998 27.775 21.775 62 21.349999999999998 29.225 26.825 22.6 63 20.95 28.1 28.349999999999998 22.6 64 22.825 28.225 28.075 20.875 65 21.625 28.7 27.725 21.95 66 20.45 29.675 27.450000000000003 22.425 67 22.025 28.475 28.625 20.875 68 22.2 27.6 27.950000000000003 22.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 2.0 19 3.0 20 2.0 21 3.5 22 6.0 23 6.0 24 5.5 25 5.0 26 11.5 27 18.5 28 19.0 29 28.0 30 44.5 31 52.0 32 68.5 33 86.0 34 87.0 35 101.5 36 145.0 37 174.0 38 214.0 39 270.0 40 286.0 41 286.0 42 337.5 43 376.0 44 363.0 45 368.0 46 345.5 47 318.0 48 301.5 49 255.0 50 225.0 51 202.5 52 153.0 53 126.0 54 113.5 55 81.0 56 61.0 57 55.0 58 38.5 59 28.0 60 29.5 61 20.5 62 10.0 63 8.5 64 6.0 65 4.0 66 3.0 67 3.0 68 3.5 69 4.0 70 2.0 71 0.0 72 0.0 73 0.5 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.0 29 0.025 30 0.025 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.97499374843711 99.95 2 0.025006251562890724 0.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288832 spots for SRR3207760.sra Written 288832 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra Read 288820 spots for SRR3207760.sra Written 288820 spots for SRR3207760.sra SRR ids: ['SRR3207760.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nl3wkvpg SRR3207760.sra spots: 5776412 blocks: [[1, 288820], [288821, 577640], [577641, 866460], [866461, 1155280], [1155281, 1444100], [1444101, 1732920], [1732921, 2021740], [2021741, 2310560], [2310561, 2599380], [2599381, 2888200], [2888201, 3177020], [3177021, 3465840], [3465841, 3754660], [3754661, 4043480], [4043481, 4332300], [4332301, 4621120], [4621121, 4909940], [4909941, 5198760], [5198761, 5487580], [5487581, 5776412]] SRR3207760 file size 1218351 SRR3207760 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207760 SRR3207760_1.fastq Input file: SRR3207760_1.fastq trimmed: SRR3207760-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:20:14 2025 >> started Mon Feb 10 20:20:17 2025 >> done (2.649s) 5776412 reads processed; of these: 17699 ( 0.31%) short reads filtered out after trimming by size control 16853 ( 0.29%) empty reads filtered out after trimming by size control 5741860 (99.40%) reads available; of these: 341601 ( 5.95%) trimmed reads available after processing 5400259 (94.05%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 997 0.02% 19 1624 0.03% 20 2973 0.05% 21 868 0.02% 22 1151 0.02% 23 1842 0.03% 24 3115 0.05% 25 6468 0.11% 26 1420 0.02% 27 1650 0.03% 28 2344 0.04% 29 3704 0.06% 30 6813 0.12% 31 1582 0.03% 32 2034 0.04% 33 2456 0.04% 34 3968 0.07% 35 7019 0.12% 36 1630 0.03% 37 2139 0.04% 38 3074 0.05% 39 5088 0.09% 40 8849 0.15% 41 2321 0.04% 42 2310 0.04% 43 3269 0.06% 44 5731 0.10% 45 9884 0.17% 46 2331 0.04% 47 3170 0.06% 48 4728 0.08% 49 8456 0.15% 50 15868 0.28% 51 3211 0.06% 52 4119 0.07% 53 6485 0.11% 54 11470 0.20% 55 22987 0.40% 56 4217 0.07% 57 5485 0.10% 58 8350 0.15% 59 15486 0.27% 60 34634 0.60% 61 5277 0.09% 62 6909 0.12% 63 10199 0.18% 64 18258 0.32% 65 35538 0.62% 66 5088 0.09% 67 13012 0.23% 68 5400259 94.05% 5741860 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=21.25 fanout-score-rank=12 prefix-density=0.10 prefix-fanout=7.9 sequence=CACCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=14 fanout-score=210.54 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=22.1 sequence=TTCTTCTTCTTT Started job on | Feb 10 20:20:32 Started mapping on | Feb 10 20:20:32 Finished on | Feb 10 20:20:38 Mapping speed, Million of reads per hour | 3445.12 Number of input reads | 5741860 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 5489153 Uniquely mapped reads % | 95.60% Average mapped length | 66.99 Number of splices: Total | 1061270 Number of splices: Annotated (sjdb) | 1043913 Number of splices: GT/AG | 1045467 Number of splices: GC/AG | 13329 Number of splices: AT/AC | 1224 Number of splices: Non-canonical | 1250 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 177873 % of reads mapped to multiple loci | 3.10% Number of reads mapped to too many loci | 58214 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.27% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 74834 74834 74834 N_multimapping 177873 177873 177873 N_noFeature 246369 2829104 2864902 N_ambiguous 58550 8221 8880 UnstrandedReadsAssigned:5184234 PositiveStrandReadsAssigned:2651828 NegativeStrandReadsAssigned:2615371 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207760 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207760-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,741,860 reads, 5,340,794 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR3207760.ke.tsv 34699 SRR3207760.se.tsv 87100 total ==> SRR3207760.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 177 24.8815 Potri.005G024800.1.v4.1 1035 936 24 6.91692 Potri.004G059700.1.v4.1 961 862 3 0.93884 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 71.975 6.82699 Potri.016G087400.1.v4.1 270 171 167 263.45 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 19.519 3.14542 Potri.012G127500.1.v4.1 977 878 838 257.47 ==> SRR3207760.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 784 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 97 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207760 completed mapping pipeline successfully