Starting /dee2/code/volunteer_pipeline.sh SRR3207761 current disk space = 3056471740416 free memory = 1578977496 SRR3207761 SRAfilesize b995d43e42070ee74ef79bbe086f96b1 SRR3207761.sra SRR3207761.sra file validated SRR3207761 is single end SRR3207761 is conventional basespace SRR3207761 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207761_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.461 40.0 38.0 40.0 35.0 40.0 2 38.23525 40.0 38.0 40.0 35.0 40.0 3 38.23975 40.0 38.0 40.0 35.0 40.0 4 38.23625 40.0 38.0 40.0 35.0 40.0 5 38.244 40.0 38.0 40.0 35.0 40.0 6 38.24075 39.0 38.0 40.0 35.0 40.0 7 38.16975 39.0 38.0 40.0 35.0 40.0 8 38.17175 40.0 38.0 40.0 35.0 40.0 9 38.0775 39.0 38.0 40.0 35.0 40.0 10 38.08275 39.0 38.0 40.0 35.0 40.0 11 38.09275 39.0 38.0 40.0 35.0 40.0 12 37.9955 39.0 38.0 40.0 35.0 40.0 13 37.96425 39.0 38.0 40.0 34.0 40.0 14 37.92875 39.0 38.0 40.0 33.0 40.0 15 37.9155 39.0 38.0 40.0 34.0 40.0 16 37.88975 39.0 38.0 40.0 33.0 40.0 17 37.8015 39.0 38.0 40.0 33.0 40.0 18 37.7675 39.0 38.0 40.0 33.0 40.0 19 37.78725 39.0 38.0 40.0 33.0 40.0 20 37.6245 39.0 38.0 40.0 33.0 40.0 21 37.62925 39.0 38.0 40.0 33.0 40.0 22 37.551 39.0 38.0 40.0 33.0 40.0 23 37.4945 39.0 38.0 40.0 33.0 40.0 24 37.443 39.0 38.0 40.0 33.0 40.0 25 37.36975 39.0 37.0 40.0 33.0 40.0 26 37.3555 39.0 38.0 40.0 33.0 40.0 27 37.236 39.0 37.0 40.0 33.0 40.0 28 37.11225 39.0 37.0 40.0 32.0 40.0 29 37.1135 39.0 37.0 40.0 33.0 40.0 30 36.9625 39.0 36.0 40.0 32.0 40.0 31 36.99325 39.0 37.0 40.0 32.0 40.0 32 36.79775 39.0 36.0 40.0 31.0 40.0 33 36.82975 39.0 36.0 40.0 32.0 40.0 34 36.741 39.0 36.0 40.0 31.0 40.0 35 36.58 39.0 36.0 40.0 31.0 40.0 36 36.692 39.0 36.0 40.0 31.0 40.0 37 36.5315 39.0 36.0 40.0 31.0 40.0 38 36.60775 39.0 36.0 40.0 31.0 40.0 39 36.41475 39.0 36.0 40.0 31.0 40.0 40 36.21125 39.0 36.0 40.0 30.0 40.0 41 36.177 39.0 36.0 40.0 30.0 40.0 42 36.10225 39.0 36.0 40.0 30.0 40.0 43 36.09475 39.0 36.0 40.0 30.0 40.0 44 35.9915 39.0 35.0 40.0 30.0 40.0 45 35.825 38.0 35.0 40.0 30.0 40.0 46 35.93575 39.0 36.0 40.0 31.0 40.0 47 35.84675 38.0 35.0 39.0 30.0 40.0 48 35.686 38.0 35.0 39.0 30.0 40.0 49 35.6415 38.0 35.0 39.0 30.0 40.0 50 35.47525 38.0 35.0 39.0 30.0 40.0 51 35.21225 38.0 35.0 39.0 29.0 40.0 52 35.10825 38.0 35.0 39.0 29.0 40.0 53 34.9065 38.0 35.0 39.0 29.0 40.0 54 34.80325 38.0 34.0 39.0 29.0 40.0 55 34.63125 38.0 34.0 39.0 28.0 40.0 56 34.32475 38.0 34.0 39.0 28.0 40.0 57 34.06225 37.0 33.0 39.0 27.0 39.0 58 33.96625 37.0 33.0 39.0 27.0 39.0 59 33.7375 36.0 33.0 39.0 26.0 39.0 60 33.476 36.0 33.0 39.0 25.0 39.0 61 33.16175 36.0 33.0 38.0 24.0 39.0 62 32.9835 36.0 33.0 38.0 23.0 39.0 63 32.78175 36.0 33.0 38.0 23.0 39.0 64 32.62475 36.0 33.0 38.0 23.0 39.0 65 32.44125 36.0 33.0 38.0 22.0 39.0 66 32.15475 36.0 33.0 38.0 18.0 39.0 67 32.111 36.0 32.0 38.0 20.0 39.0 68 31.54075 35.0 31.0 38.0 17.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 1.0 6 0.0 7 3.0 8 3.0 9 7.0 10 2.0 11 3.0 12 2.0 13 9.0 14 10.0 15 19.0 16 14.0 17 9.0 18 15.0 19 9.0 20 14.0 21 14.0 22 16.0 23 16.0 24 32.0 25 15.0 26 26.0 27 22.0 28 44.0 29 44.0 30 58.0 31 59.0 32 91.0 33 116.0 34 147.0 35 216.0 36 337.0 37 526.0 38 1090.0 39 1008.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.782445611402853 15.778944736184048 14.753688422105526 39.68492123030758 2 22.005501375343837 20.980245061265315 34.93373343335834 22.080520130032507 3 22.980745186296573 24.956239059764943 27.306826706676667 24.756189047261813 4 26.875 30.049999999999997 19.950000000000003 23.125 5 27.0 33.925 22.075 17.0 6 19.950000000000003 38.1 22.525000000000002 19.425 7 17.474999999999998 20.525 42.325 19.675 8 20.45 24.775 29.875 24.9 9 20.65 23.225 31.775 24.349999999999998 10 18.925 39.6 24.275 17.2 11 24.875 29.975 22.225 22.925 12 20.95 25.324999999999996 30.175 23.549999999999997 13 20.375 28.175 31.574999999999996 19.875 14 22.225 27.125 29.5 21.15 15 21.175 27.875 28.625 22.325 16 21.9 27.6 28.799999999999997 21.7 17 23.400000000000002 29.075 26.974999999999998 20.549999999999997 18 21.0 29.549999999999997 27.250000000000004 22.2 19 21.55 28.025 27.775 22.650000000000002 20 22.125 28.15 27.3 22.425 21 22.125 27.900000000000002 28.175 21.8 22 21.575 28.349999999999998 28.425 21.65 23 22.15 30.349999999999998 26.075 21.425 24 21.775 28.749999999999996 26.924999999999997 22.55 25 21.45 28.875 27.6 22.075 26 21.55 28.625 27.125 22.7 27 21.375 28.799999999999997 29.275000000000002 20.549999999999997 28 21.925 27.6 27.6 22.875 29 22.3 29.799999999999997 26.650000000000002 21.25 30 21.2 28.975 27.800000000000004 22.025 31 21.6 28.549999999999997 27.474999999999998 22.375 32 22.775000000000002 27.925 27.800000000000004 21.5 33 21.224999999999998 28.825 27.625 22.325 34 22.825 26.474999999999998 28.299999999999997 22.400000000000002 35 21.955488872218055 28.80720180045011 27.25681420355089 21.980495123780948 36 20.78019504876219 28.68217054263566 27.131782945736433 23.40585146286572 37 21.405351337834457 28.432108027006752 27.60690172543136 22.55563890972743 38 22.2 28.999999999999996 26.174999999999997 22.625 39 21.925 27.425 27.825 22.825 40 23.150000000000002 28.349999999999998 27.150000000000002 21.349999999999998 41 21.275 27.575 28.225 22.925 42 22.35 27.35 28.825 21.475 43 21.525 28.225 27.200000000000003 23.05 44 22.45 29.099999999999998 26.625 21.825 45 21.75 27.725 27.900000000000002 22.625 46 22.35 28.675 27.500000000000004 21.475 47 22.175 28.749999999999996 27.375 21.7 48 21.43035758939735 27.406851712928233 27.60690172543136 23.55588897224306 49 21.675 28.925 27.375 22.025 50 22.225 29.625 25.55 22.6 51 22.48062015503876 28.432108027006752 27.406851712928233 21.680420105026258 52 22.25 28.975 27.325 21.45 53 21.9 28.975 26.6 22.525000000000002 54 22.05 27.375 28.249999999999996 22.325 55 21.55 28.749999999999996 27.375 22.325 56 21.625 27.950000000000003 28.975 21.45 57 21.775 28.175 28.4 21.65 58 21.725 27.375 28.225 22.675 59 21.875 27.375 28.749999999999996 22.0 60 21.224999999999998 28.299999999999997 28.050000000000004 22.425 61 22.275 27.6 27.325 22.8 62 22.925 28.050000000000004 27.125 21.9 63 22.5 28.15 27.075 22.275 64 22.675 28.075 28.175 21.075 65 22.975 28.050000000000004 27.3 21.675 66 21.325 27.325 29.175 22.175 67 22.925 27.700000000000003 27.575 21.8 68 23.0 27.05 27.425 22.525000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.5 3 1.0 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 2.0 22 2.0 23 2.5 24 6.0 25 9.0 26 12.0 27 12.5 28 10.0 29 16.0 30 28.5 31 35.0 32 41.0 33 64.5 34 82.0 35 102.5 36 141.5 37 160.0 38 204.5 39 264.0 40 307.0 41 335.0 42 358.5 43 377.5 44 373.0 45 372.5 46 354.5 47 337.0 48 311.0 49 278.5 50 272.0 51 230.0 52 157.5 53 127.0 54 106.0 55 78.0 56 71.0 57 59.0 58 35.5 59 24.0 60 20.0 61 14.0 62 12.0 63 11.5 64 8.0 65 5.0 66 5.0 67 4.0 68 1.5 69 0.0 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.025 36 0.025 37 0.025 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.025 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.2005515166708448 0.4 3 0.0 0.0 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183953 spots for SRR3207761.sra Written 183953 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra Read 183952 spots for SRR3207761.sra Written 183952 spots for SRR3207761.sra SRR ids: ['SRR3207761.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f_7bx9pp SRR3207761.sra spots: 3679041 blocks: [[1, 183952], [183953, 367904], [367905, 551856], [551857, 735808], [735809, 919760], [919761, 1103712], [1103713, 1287664], [1287665, 1471616], [1471617, 1655568], [1655569, 1839520], [1839521, 2023472], [2023473, 2207424], [2207425, 2391376], [2391377, 2575328], [2575329, 2759280], [2759281, 2943232], [2943233, 3127184], [3127185, 3311136], [3311137, 3495088], [3495089, 3679041]] SRR3207761 file size 775577 SRR3207761 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207761 SRR3207761_1.fastq Input file: SRR3207761_1.fastq trimmed: SRR3207761-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:02:24 2025 >> started Mon Feb 10 21:02:27 2025 >> done (2.791s) 3679041 reads processed; of these: 10446 ( 0.28%) short reads filtered out after trimming by size control 10286 ( 0.28%) empty reads filtered out after trimming by size control 3658309 (99.44%) reads available; of these: 229098 ( 6.26%) trimmed reads available after processing 3429211 (93.74%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 600 0.02% 19 1026 0.03% 20 1824 0.05% 21 539 0.01% 22 748 0.02% 23 1165 0.03% 24 2025 0.06% 25 4044 0.11% 26 832 0.02% 27 1078 0.03% 28 1496 0.04% 29 2359 0.06% 30 4377 0.12% 31 1076 0.03% 32 1289 0.04% 33 1618 0.04% 34 2652 0.07% 35 4609 0.13% 36 1074 0.03% 37 1479 0.04% 38 2030 0.06% 39 3421 0.09% 40 5908 0.16% 41 1445 0.04% 42 1488 0.04% 43 2156 0.06% 44 3774 0.10% 45 6820 0.19% 46 1533 0.04% 47 2141 0.06% 48 3100 0.08% 49 5641 0.15% 50 10479 0.29% 51 2195 0.06% 52 2890 0.08% 53 4277 0.12% 54 7712 0.21% 55 15443 0.42% 56 2942 0.08% 57 3741 0.10% 58 5675 0.16% 59 10701 0.29% 60 23460 0.64% 61 3565 0.10% 62 4658 0.13% 63 7121 0.19% 64 12868 0.35% 65 23736 0.65% 66 3548 0.10% 67 8720 0.24% 68 3429211 93.74% 3658309 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=4.23 fanout-score-rank=20 prefix-density=0.05 prefix-fanout=3.9 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=13 fanout-score=202.16 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=21.2 sequence=TTCTTCTTCTTT Started job on | Feb 10 21:02:42 Started mapping on | Feb 10 21:02:42 Finished on | Feb 10 21:02:48 Mapping speed, Million of reads per hour | 2194.99 Number of input reads | 3658309 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 3504849 Uniquely mapped reads % | 95.81% Average mapped length | 66.97 Number of splices: Total | 692709 Number of splices: Annotated (sjdb) | 681541 Number of splices: GT/AG | 682611 Number of splices: GC/AG | 8602 Number of splices: AT/AC | 744 Number of splices: Non-canonical | 752 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.81 Insertion rate per base | 0.01% Insertion average length | 1.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 115028 % of reads mapped to multiple loci | 3.14% Number of reads mapped to too many loci | 25958 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.28% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 38432 38432 38432 N_multimapping 115028 115028 115028 N_noFeature 128442 1790592 1818514 N_ambiguous 34713 5196 5367 UnstrandedReadsAssigned:3341694 PositiveStrandReadsAssigned:1709061 NegativeStrandReadsAssigned:1680968 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207761 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207761-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,658,309 reads, 3,433,465 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,001 rounds 52401 SRR3207761.ke.tsv 34699 SRR3207761.se.tsv 87100 total ==> SRR3207761.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 135 29.9991 Potri.005G024800.1.v4.1 1035 936 12 5.46707 Potri.004G059700.1.v4.1 961 862 9 4.4523 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 38.2932 5.74171 Potri.016G087400.1.v4.1 270 171 133 331.669 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 10 2.54738 Potri.012G127500.1.v4.1 977 878 666 323.466 ==> SRR3207761.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 509 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 62 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207761 completed mapping pipeline successfully