Starting /dee2/code/volunteer_pipeline.sh SRR3207762 current disk space = 3056075026432 free memory = 1501047044 SRR3207762 SRAfilesize 5cb4bea88c61c5504068e623dad45d69 SRR3207762.sra SRR3207762.sra file validated SRR3207762 is single end SRR3207762 is conventional basespace SRR3207762 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207762_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.76875 34.0 31.0 34.0 30.0 34.0 2 32.02375 34.0 31.0 34.0 30.0 34.0 3 32.83775 34.0 31.0 34.0 30.0 34.0 4 36.478 37.0 37.0 37.0 35.0 37.0 5 36.4255 37.0 37.0 37.0 35.0 37.0 6 36.15825 37.0 37.0 37.0 35.0 37.0 7 36.3955 37.0 37.0 37.0 35.0 37.0 8 36.3375 37.0 37.0 37.0 35.0 37.0 9 38.291 39.0 39.0 39.0 37.0 39.0 10-11 38.343375 39.0 39.0 39.0 37.0 39.0 12-13 38.242625000000004 39.0 39.0 39.0 37.0 39.0 14-15 39.8405 41.0 40.0 41.0 37.5 41.0 16-17 39.94925 41.0 40.0 41.0 38.0 41.0 18-19 39.850125 41.0 40.0 41.0 37.5 41.0 20-21 39.62775 41.0 40.0 41.0 37.0 41.0 22-23 39.435500000000005 41.0 39.0 41.0 36.5 41.0 24-25 39.227375 41.0 39.0 41.0 36.0 41.0 26-27 38.5005 40.0 38.0 41.0 34.0 41.0 28-29 38.553625 40.0 38.0 41.0 34.0 41.0 30-31 38.492374999999996 40.0 38.0 41.0 34.5 41.0 32-33 38.522125 40.0 38.0 41.0 34.5 41.0 34-35 38.371125000000006 40.0 38.0 41.0 34.0 41.0 36-37 38.238625 40.0 38.5 41.0 33.5 41.0 38-39 38.830375000000004 41.0 39.0 41.0 35.5 41.0 40-41 38.896125 41.0 39.0 41.0 35.5 41.0 42-43 38.64425 41.0 39.0 41.0 35.0 41.0 44-45 38.579875 41.0 39.0 41.0 35.0 41.0 46-47 38.110125 40.5 38.5 41.0 33.5 41.0 48-49 38.0385 40.0 38.0 41.0 33.0 41.0 50-51 37.94775 40.0 38.0 41.0 33.0 41.0 52-53 37.906 40.0 38.0 41.0 33.0 41.0 54-55 37.775625000000005 40.0 38.0 41.0 33.0 41.0 56-57 37.418875 40.0 37.5 41.0 32.5 41.0 58-59 36.779875000000004 40.0 36.5 41.0 30.5 41.0 60-61 36.6305 39.5 36.0 41.0 30.5 41.0 62-63 36.412375 39.0 36.0 41.0 30.0 41.0 64-65 36.112375 39.0 35.0 41.0 29.5 41.0 66-67 35.873625000000004 38.5 35.0 40.0 30.0 41.0 68-69 34.697 37.0 34.5 39.5 26.5 41.0 70-71 34.446875000000006 37.0 34.0 39.0 26.5 41.0 72-73 34.08675 36.5 34.0 39.0 26.5 40.5 74-75 33.657250000000005 36.0 34.0 38.5 26.0 39.5 76-77 32.576625 35.0 32.5 37.0 26.0 39.0 78-79 32.955625 35.0 34.0 37.0 26.0 39.0 80-81 32.520250000000004 35.0 33.0 36.5 25.5 38.0 82-83 32.161 35.0 33.0 36.0 25.0 37.0 84-85 31.893250000000002 35.0 33.0 36.0 25.0 37.0 86-87 31.244 35.0 32.5 35.0 21.5 36.0 88-89 30.374625 34.5 31.0 35.0 16.5 36.0 90-91 30.159875 34.5 31.0 35.0 9.5 36.0 92-93 29.40575 34.0 30.0 35.0 3.5 35.0 94-95 28.918375 34.0 29.0 35.0 2.0 35.0 96-97 28.99625 34.0 29.5 35.0 2.0 35.0 98-99 29.06275 34.0 30.5 35.0 2.0 35.0 100 28.81475 34.0 31.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 4.0 10 2.0 11 7.0 12 9.0 13 9.0 14 13.0 15 11.0 16 14.0 17 7.0 18 23.0 19 21.0 20 10.0 21 15.0 22 19.0 23 16.0 24 24.0 25 31.0 26 28.0 27 42.0 28 38.0 29 68.0 30 61.0 31 72.0 32 86.0 33 100.0 34 165.0 35 201.0 36 394.0 37 845.0 38 1384.0 39 278.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.2689506339358 15.538171027785271 16.158618829241973 39.03425950903696 2 20.200000000000003 24.075 37.075 18.65 3 22.8 27.250000000000004 27.525 22.425 4 23.05 34.2 20.75 22.0 5 24.85621405351338 36.55913978494624 21.705426356589147 16.879219804951237 6 18.375 37.25 24.825 19.55 7 16.025 17.775 44.15 22.05 8 19.025 23.45 29.7 27.825 9 20.65 24.05 31.65 23.65 10-11 23.025000000000002 33.287499999999994 22.275 21.4125 12-13 19.6375 26.5375 30.65 23.175 14-15 21.525 27.425 28.65 22.400000000000002 16-17 21.625 29.1875 27.9125 21.275 18-19 22.287499999999998 26.987499999999997 28.249999999999996 22.475 20-21 21.65 28.6125 27.1375 22.6 22-23 21.087500000000002 28.65 28.6125 21.65 24-25 21.6125 28.962500000000002 27.537499999999998 21.8875 26-27 21.8625 30.025000000000002 26.5375 21.575 28-29 20.9125 28.787499999999998 28.325 21.975 30-31 21.349999999999998 28.8875 27.775 21.987499999999997 32-33 21.2875 28.3875 28.025 22.3 34-35 21.575 27.725 28.3625 22.3375 36-37 21.099999999999998 27.925 28.5875 22.3875 38-39 21.8875 28.1125 27.3125 22.6875 40-41 21.025 28.125 28.175 22.675 42-43 21.5375 28.549999999999997 28.237499999999997 21.675 44-45 22.325 28.1125 27.9375 21.625 46-47 21.9375 28.6625 27.975 21.425 48-49 21.515189398674835 28.403550443805475 27.87848481060132 22.202775346918365 50-51 21.3625 28.475 28.425 21.7375 52-53 21.625 27.787499999999998 27.9125 22.675 54-55 21.640205025628205 28.6160770096262 27.090886360795096 22.652831603950492 56-57 21.795673377516568 26.972614730523947 29.260972864824307 21.970739027135174 58-59 21.675 27.962500000000002 28.012500000000003 22.35 60-61 22.2 28.1375 27.437499999999996 22.225 62-63 22.175 29.1375 26.787499999999998 21.9 64-65 21.925 28.812500000000004 27.224999999999998 22.037499999999998 66-67 21.637500000000003 28.175 28.3625 21.825 68-69 21.8 28.3625 27.85 21.987499999999997 70-71 22.1375 27.625 27.8375 22.400000000000002 72-73 22.052756594574323 27.628453556694588 28.778597324665583 21.540192524065507 74-75 21.587500000000002 28.175 27.650000000000002 22.5875 76-77 21.565195649456182 27.715964495561945 28.79109888736092 21.927740967620952 78-79 21.8304576144036 27.981995498874717 28.14453613403351 22.043010752688172 80-81 22.468117029257314 28.08202050512628 28.069517379344838 21.380345086271568 82-83 22.55 28.3375 28.1625 20.95 84-85 22.37648530331457 28.080050031269543 27.30456535334584 22.238899312070043 86-87 22.83070767691923 28.182045511377847 27.74443610902726 21.24281070267567 88-89 22.6375 28.1 27.425 21.837500000000002 90-91 22.1 28.549999999999997 27.6625 21.6875 92-93 22.162499999999998 28.249999999999996 27.825 21.762500000000003 94-95 22.075 27.85 28.212500000000002 21.8625 96-97 21.340167520940117 28.141017627203404 28.166020752594072 22.352794099262407 98-99 21.75 28.050000000000004 28.0625 22.1375 100 23.225 26.650000000000002 27.35 22.775000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 1.5 23 1.5 24 2.0 25 4.0 26 5.5 27 9.5 28 14.5 29 15.0 30 19.5 31 27.0 32 43.0 33 55.5 34 59.5 35 73.5 36 93.0 37 116.0 38 146.5 39 165.5 40 191.5 41 228.0 42 251.0 43 261.5 44 268.0 45 279.5 46 262.5 47 239.5 48 217.0 49 168.5 50 142.5 51 140.0 52 109.5 53 81.5 54 70.0 55 53.5 56 35.5 57 23.5 58 19.0 59 13.5 60 10.0 61 11.0 62 12.5 63 8.5 64 8.5 65 9.0 66 4.5 67 2.5 68 1.0 69 2.0 70 2.0 71 1.5 72 2.0 73 2.0 74 1.5 75 1.5 76 1.5 77 2.0 78 2.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.324999999999999 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0125 50-51 0.0 52-53 0.0 54-55 0.0125 56-57 0.0375 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0125 78-79 0.025 80-81 0.025 82-83 0.0 84-85 0.0625 86-87 0.025 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0125 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731772 spots for SRR3207762.sra Written 1731772 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra Read 1731763 spots for SRR3207762.sra Written 1731763 spots for SRR3207762.sra SRR ids: ['SRR3207762.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7shiqkui SRR3207762.sra spots: 34635269 blocks: [[1, 1731763], [1731764, 3463526], [3463527, 5195289], [5195290, 6927052], [6927053, 8658815], [8658816, 10390578], [10390579, 12122341], [12122342, 13854104], [13854105, 15585867], [15585868, 17317630], [17317631, 19049393], [19049394, 20781156], [20781157, 22512919], [22512920, 24244682], [24244683, 25976445], [25976446, 27708208], [27708209, 29439971], [29439972, 31171734], [31171735, 32903497], [32903498, 34635269]] SRR3207762 file size 9002740 SRR3207762 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207762 SRR3207762_1.fastq Input file: SRR3207762_1.fastq trimmed: SRR3207762-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:33:57 2025 >> started Mon Feb 10 20:34:13 2025 >> done (15.735s) 34635269 reads processed; of these: 5996 ( 0.02%) short reads filtered out after trimming by size control 26291 ( 0.08%) empty reads filtered out after trimming by size control 34602982 (99.91%) reads available; of these: 3159817 ( 9.13%) trimmed reads available after processing 31443165 (90.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1700 0.00% 19 2368 0.01% 20 3430 0.01% 21 4914 0.01% 22 6728 0.02% 23 9659 0.03% 24 13526 0.04% 25 17965 0.05% 26 17577 0.05% 27 17314 0.05% 28 18236 0.05% 29 18621 0.05% 30 19103 0.06% 31 19961 0.06% 32 20125 0.06% 33 19943 0.06% 34 20365 0.06% 35 20606 0.06% 36 21800 0.06% 37 22028 0.06% 38 22127 0.06% 39 22920 0.07% 40 23513 0.07% 41 24178 0.07% 42 25234 0.07% 43 25626 0.07% 44 26718 0.08% 45 26673 0.08% 46 27345 0.08% 47 27388 0.08% 48 27113 0.08% 49 27888 0.08% 50 27915 0.08% 51 28584 0.08% 52 28487 0.08% 53 28739 0.08% 54 28761 0.08% 55 28651 0.08% 56 28928 0.08% 57 29407 0.08% 58 28528 0.08% 59 29152 0.08% 60 28945 0.08% 61 28765 0.08% 62 29451 0.09% 63 29312 0.08% 64 29848 0.09% 65 30311 0.09% 66 31103 0.09% 67 31970 0.09% 68 32257 0.09% 69 32026 0.09% 70 33874 0.10% 71 33774 0.10% 72 34153 0.10% 73 35006 0.10% 74 34736 0.10% 75 36374 0.11% 76 25538 0.07% 77 28413 0.08% 78 32040 0.09% 79 34313 0.10% 80 36171 0.10% 81 37504 0.11% 82 38544 0.11% 83 41069 0.12% 84 42813 0.12% 85 44821 0.13% 86 45520 0.13% 87 48388 0.14% 88 52171 0.15% 89 55687 0.16% 90 60972 0.18% 91 67975 0.20% 92 76647 0.22% 93 86228 0.25% 94 102547 0.30% 95 120767 0.35% 96 137581 0.40% 97 174115 0.50% 98 187483 0.54% 99 180761 0.52% 100 31443165 90.87% 34602982 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=25 prefix-density=0.03 prefix-fanout=3.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=239.61 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=14.6 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCTATTACCCCCCCTCTTGAG Started job on | Feb 10 20:34:32 Started mapping on | Feb 10 20:34:32 Finished on | Feb 10 20:35:05 Mapping speed, Million of reads per hour | 3774.87 Number of input reads | 34602982 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 33231037 Uniquely mapped reads % | 96.04% Average mapped length | 97.57 Number of splices: Total | 9359745 Number of splices: Annotated (sjdb) | 9189197 Number of splices: GT/AG | 9223072 Number of splices: GC/AG | 112392 Number of splices: AT/AC | 9415 Number of splices: Non-canonical | 14866 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.02% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 773602 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 420480 % of reads mapped to too many loci | 1.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 598343 598343 598343 N_multimapping 773602 773602 773602 N_noFeature 1486910 17151534 17324899 N_ambiguous 357587 57907 58608 UnstrandedReadsAssigned:31386540 PositiveStrandReadsAssigned:16021596 NegativeStrandReadsAssigned:15847530 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207762 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207762-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,602,982 reads, 32,182,242 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR3207762.ke.tsv 34699 SRR3207762.se.tsv 87100 total ==> SRR3207762.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1148 28.668 Potri.005G024800.1.v4.1 1035 936 129.01 6.60507 Potri.004G059700.1.v4.1 961 862 42 2.33492 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 540.023 9.0994 Potri.016G087400.1.v4.1 270 171 1193 334.33 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 102.557 2.93589 Potri.012G127500.1.v4.1 977 878 1846 100.755 ==> SRR3207762.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3715 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 580 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 71 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 22 SRR3207762 completed mapping pipeline successfully