Starting /dee2/code/volunteer_pipeline.sh SRR3207763 current disk space = 3056262512640 free memory = 1444218368 SRR3207763 SRAfilesize bfbbf24d391c889adb0ea7fe1285f03b SRR3207763.sra SRR3207763.sra file validated SRR3207763 is single end SRR3207763 is conventional basespace SRR3207763 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207763_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.299 39.0 38.0 40.0 35.0 40.0 2 37.72075 39.0 38.0 40.0 34.0 40.0 3 38.04475 39.0 38.0 40.0 34.0 40.0 4 38.0565 39.0 38.0 40.0 35.0 40.0 5 38.07325 39.0 38.0 40.0 35.0 40.0 6 38.15475 39.0 38.0 40.0 35.0 40.0 7 38.16075 39.0 38.0 40.0 35.0 40.0 8 38.09175 39.0 38.0 40.0 35.0 40.0 9 38.10175 39.0 38.0 40.0 35.0 40.0 10 37.977 39.0 38.0 40.0 33.0 40.0 11 37.943 39.0 38.0 40.0 34.0 40.0 12 37.8555 39.0 38.0 40.0 34.0 40.0 13 37.8025 39.0 38.0 40.0 33.0 40.0 14 37.7705 39.0 38.0 40.0 33.0 40.0 15 37.6675 39.0 38.0 40.0 33.0 40.0 16 37.7395 39.0 38.0 40.0 33.0 40.0 17 37.62375 39.0 38.0 40.0 33.0 40.0 18 37.53825 39.0 38.0 40.0 33.0 40.0 19 37.47975 39.0 38.0 40.0 33.0 40.0 20 37.426 39.0 38.0 40.0 33.0 40.0 21 37.398 39.0 38.0 40.0 33.0 40.0 22 37.27475 39.0 37.0 40.0 33.0 40.0 23 37.168 39.0 37.0 40.0 33.0 40.0 24 37.20825 39.0 37.0 40.0 33.0 40.0 25 36.9955 39.0 36.0 40.0 32.0 40.0 26 37.01375 39.0 37.0 40.0 33.0 40.0 27 36.882 39.0 36.0 40.0 32.0 40.0 28 36.79725 39.0 36.0 40.0 32.0 40.0 29 36.619 39.0 36.0 40.0 31.0 40.0 30 36.522 39.0 36.0 40.0 31.0 40.0 31 36.324 39.0 36.0 40.0 31.0 40.0 32 36.17925 39.0 35.0 40.0 30.0 40.0 33 36.14775 39.0 35.0 40.0 30.0 40.0 34 36.07125 39.0 35.0 40.0 30.0 40.0 35 35.94525 39.0 35.0 40.0 30.0 40.0 36 36.14225 39.0 36.0 40.0 30.0 40.0 37 36.0015 39.0 35.0 40.0 30.0 40.0 38 35.88925 39.0 35.0 40.0 30.0 40.0 39 35.67925 38.0 35.0 40.0 29.0 40.0 40 35.584 38.0 35.0 40.0 29.0 40.0 41 35.45325 38.0 35.0 39.0 29.0 40.0 42 35.414 38.0 35.0 39.0 29.0 40.0 43 35.1815 38.0 35.0 39.0 29.0 40.0 44 35.10425 38.0 35.0 39.0 29.0 40.0 45 34.91575 38.0 34.0 39.0 28.0 40.0 46 34.93325 38.0 35.0 39.0 29.0 40.0 47 34.8475 38.0 35.0 39.0 29.0 40.0 48 34.6315 38.0 34.0 39.0 28.0 40.0 49 34.463 37.0 34.0 39.0 28.0 40.0 50 34.1485 37.0 33.0 39.0 27.0 40.0 51 34.0635 37.0 34.0 39.0 27.0 39.0 52 33.81875 36.0 33.0 39.0 27.0 39.0 53 33.627 36.0 33.0 39.0 26.0 39.0 54 33.44425 36.0 33.0 39.0 25.0 39.0 55 33.40425 36.0 33.0 38.0 26.0 39.0 56 33.00475 36.0 33.0 38.0 23.0 39.0 57 32.6615 36.0 33.0 38.0 23.0 39.0 58 32.33875 36.0 33.0 38.0 23.0 39.0 59 32.185 36.0 32.0 38.0 21.0 39.0 60 31.94175 35.0 32.0 38.0 20.0 39.0 61 31.66525 36.0 32.0 38.0 13.0 39.0 62 31.4555 35.0 32.0 38.0 7.0 39.0 63 31.1275 35.0 31.0 37.0 2.0 39.0 64 30.951 35.0 31.0 37.0 2.0 38.0 65 30.659 35.0 31.0 36.0 2.0 38.0 66 30.14775 35.0 31.0 36.0 2.0 38.0 67 29.8635 34.0 30.0 36.0 2.0 38.0 68 29.475 33.0 29.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 2.0 6 5.0 7 0.0 8 4.0 9 8.0 10 9.0 11 16.0 12 8.0 13 9.0 14 7.0 15 9.0 16 11.0 17 12.0 18 17.0 19 17.0 20 16.0 21 24.0 22 19.0 23 28.0 24 20.0 25 34.0 26 42.0 27 35.0 28 44.0 29 47.0 30 65.0 31 76.0 32 96.0 33 124.0 34 185.0 35 253.0 36 434.0 37 642.0 38 1126.0 39 550.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.621466099574683 15.361521140855642 13.785339004253188 42.23167375531649 2 21.149949341438703 23.353596757852078 37.537993920972646 17.958459979736578 3 22.025 27.35 27.750000000000004 22.875 4 24.975 33.375 20.175 21.475 5 26.1 35.65 22.225 16.025 6 18.3 37.724999999999994 24.45 19.525000000000002 7 16.400000000000002 17.825 44.725 21.05 8 18.65 23.125 30.225 28.000000000000004 9 20.025000000000002 22.6 31.45 25.924999999999997 10 19.7 38.824999999999996 23.925 17.549999999999997 11 24.9 30.825000000000003 21.2 23.075000000000003 12 21.475 25.1 29.349999999999998 24.075 13 19.650000000000002 28.4 30.9 21.05 14 21.325 27.425 30.65 20.599999999999998 15 22.075 28.749999999999996 26.900000000000002 22.275 16 21.725 28.749999999999996 28.225 21.3 17 23.075000000000003 27.3 27.075 22.55 18 21.975 28.125 27.925 21.975 19 21.224999999999998 29.049999999999997 27.625 22.1 20 21.224999999999998 29.575000000000003 28.549999999999997 20.65 21 21.725 27.375 27.675 23.225 22 21.775 28.025 26.875 23.325000000000003 23 21.3 29.575000000000003 27.975 21.15 24 20.7 28.525 27.875 22.900000000000002 25 21.5 28.975 27.474999999999998 22.05 26 22.25 27.150000000000002 27.0 23.599999999999998 27 21.475 27.175 27.725 23.625 28 21.85 28.65 28.449999999999996 21.05 29 21.25 29.25 27.725 21.775 30 21.825 27.825 28.575 21.775 31 21.85 27.6 28.775000000000002 21.775 32 22.225 29.15 27.925 20.7 33 21.85 28.375 27.500000000000004 22.275 34 21.75 29.299999999999997 28.349999999999998 20.599999999999998 35 21.125 28.95 27.325 22.6 36 20.7 29.549999999999997 27.625 22.125 37 20.849999999999998 27.575 29.275000000000002 22.3 38 22.525000000000002 29.2 26.674999999999997 21.6 39 22.075 28.025 27.950000000000003 21.95 40 22.05 28.349999999999998 26.575 23.025000000000002 41 20.599999999999998 28.975 28.15 22.275 42 21.05 28.575 27.950000000000003 22.425 43 21.75 28.075 28.599999999999998 21.575 44 21.9 28.825 27.650000000000002 21.625 45 21.775 28.775000000000002 28.375 21.075 46 22.0 26.875 28.425 22.7 47 22.8 27.700000000000003 27.250000000000004 22.25 48 22.125 27.950000000000003 28.9 21.025 49 22.325 27.1 28.599999999999998 21.975 50 21.575 28.975 28.575 20.875 51 22.3 28.499999999999996 27.325 21.875 52 22.6 27.825 27.525 22.05 53 21.3 28.925 27.05 22.725 54 21.2 28.549999999999997 28.549999999999997 21.7 55 21.525 28.199999999999996 27.500000000000004 22.775000000000002 56 22.7 28.000000000000004 27.875 21.425 57 21.025 28.199999999999996 27.750000000000004 23.025000000000002 58 22.225 29.275000000000002 28.075 20.424999999999997 59 21.55 27.625 28.549999999999997 22.275 60 21.349999999999998 28.799999999999997 27.35 22.5 61 23.125 26.775 28.725 21.375 62 20.925 28.475 27.925 22.675 63 21.375 27.075 30.475 21.075 64 22.175 27.175 28.799999999999997 21.85 65 22.7 27.400000000000002 27.6 22.3 66 22.625 28.4 27.1 21.875 67 21.325 28.475 28.775000000000002 21.425 68 21.65 29.175 28.325 20.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.5 18 2.0 19 1.0 20 2.0 21 6.5 22 10.0 23 7.5 24 9.5 25 14.0 26 15.0 27 20.5 28 25.0 29 31.5 30 51.5 31 65.0 32 76.0 33 91.5 34 96.0 35 111.5 36 165.0 37 203.0 38 217.5 39 263.5 40 308.0 41 321.0 42 330.5 43 346.5 44 353.0 45 353.0 46 323.0 47 293.0 48 293.5 49 259.0 50 224.0 51 193.5 52 144.0 53 125.0 54 102.5 55 71.5 56 63.0 57 57.5 58 38.5 59 25.0 60 28.5 61 21.5 62 11.0 63 11.5 64 9.0 65 6.5 66 7.0 67 6.0 68 5.0 69 5.0 70 4.0 71 3.0 72 3.0 73 3.5 74 2.5 75 1.0 76 1.5 77 1.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 1.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.17548257708698922 0.35000000000000003 3 0.0501378791677112 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.075 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.075 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.075 0.0 0.0 0.0 0.0 56 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433290 spots for SRR3207763.sra Written 433290 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra Read 433283 spots for SRR3207763.sra Written 433283 spots for SRR3207763.sra SRR ids: ['SRR3207763.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u7sfzdj4 SRR3207763.sra spots: 8665667 blocks: [[1, 433283], [433284, 866566], [866567, 1299849], [1299850, 1733132], [1733133, 2166415], [2166416, 2599698], [2599699, 3032981], [3032982, 3466264], [3466265, 3899547], [3899548, 4332830], [4332831, 4766113], [4766114, 5199396], [5199397, 5632679], [5632680, 6065962], [6065963, 6499245], [6499246, 6932528], [6932529, 7365811], [7365812, 7799094], [7799095, 8232377], [8232378, 8665667]] SRR3207763 file size 1828397 SRR3207763 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207763 SRR3207763_1.fastq Input file: SRR3207763_1.fastq trimmed: SRR3207763-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:04:31 2025 >> started Mon Feb 10 20:04:35 2025 >> done (3.919s) 8665667 reads processed; of these: 21284 ( 0.25%) short reads filtered out after trimming by size control 16012 ( 0.18%) empty reads filtered out after trimming by size control 8628371 (99.57%) reads available; of these: 637038 ( 7.38%) trimmed reads available after processing 7991333 (92.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1832 0.02% 19 2727 0.03% 20 4856 0.06% 21 1427 0.02% 22 1932 0.02% 23 2949 0.03% 24 4964 0.06% 25 8841 0.10% 26 2183 0.03% 27 2780 0.03% 28 4021 0.05% 29 6521 0.08% 30 11358 0.13% 31 2850 0.03% 32 3483 0.04% 33 4381 0.05% 34 7052 0.08% 35 11612 0.13% 36 2967 0.03% 37 4050 0.05% 38 5717 0.07% 39 9554 0.11% 40 15620 0.18% 41 4443 0.05% 42 4368 0.05% 43 6114 0.07% 44 10241 0.12% 45 17855 0.21% 46 4520 0.05% 47 5921 0.07% 48 8811 0.10% 49 15442 0.18% 50 28062 0.33% 51 6169 0.07% 52 7978 0.09% 53 12267 0.14% 54 21001 0.24% 55 39388 0.46% 56 8063 0.09% 57 10596 0.12% 58 16468 0.19% 59 29590 0.34% 60 58636 0.68% 61 10583 0.12% 62 13982 0.16% 63 21234 0.25% 64 36930 0.43% 65 68369 0.79% 66 12256 0.14% 67 34074 0.39% 68 7991333 92.62% 8628371 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=22 prefix-density=0.04 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=8 fanout-score=96.08 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=15.6 sequence=AAAAGAAAAGAAA Started job on | Feb 10 20:04:51 Started mapping on | Feb 10 20:04:51 Finished on | Feb 10 20:04:59 Mapping speed, Million of reads per hour | 3882.77 Number of input reads | 8628371 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 8047597 Uniquely mapped reads % | 93.27% Average mapped length | 66.85 Number of splices: Total | 1498519 Number of splices: Annotated (sjdb) | 1470932 Number of splices: GT/AG | 1476146 Number of splices: GC/AG | 18578 Number of splices: AT/AC | 1621 Number of splices: Non-canonical | 2174 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.01% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265324 % of reads mapped to multiple loci | 3.08% Number of reads mapped to too many loci | 280488 % of reads mapped to too many loci | 3.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 315450 315450 315450 N_multimapping 265324 265324 265324 N_noFeature 462395 4196292 4260720 N_ambiguous 81437 14060 14490 UnstrandedReadsAssigned:7503765 PositiveStrandReadsAssigned:3837245 NegativeStrandReadsAssigned:3772387 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207763 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207763-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,628,371 reads, 7,898,311 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 993 rounds 52401 SRR3207763.ke.tsv 34699 SRR3207763.se.tsv 87100 total ==> SRR3207763.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 259.45 26.8636 Potri.005G024800.1.v4.1 1035 936 49 10.4017 Potri.004G059700.1.v4.1 961 862 7 1.61353 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 155.565 10.8684 Potri.016G087400.1.v4.1 270 171 259 300.946 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 29 3.44214 Potri.012G127500.1.v4.1 977 878 325 73.5486 ==> SRR3207763.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1175 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 176 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207763 completed mapping pipeline successfully