Starting /dee2/code/volunteer_pipeline.sh SRR3207764 current disk space = 3056900550656 free memory = 1577795196 SRR3207764 SRAfilesize e0bf0d0f4f59b9afc2158b52c05d244f SRR3207764.sra SRR3207764.sra file validated SRR3207764 is single end SRR3207764 is conventional basespace SRR3207764 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207764_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.3775 40.0 38.0 40.0 35.0 40.0 2 37.882 39.0 38.0 40.0 35.0 40.0 3 38.182 39.0 38.0 40.0 35.0 40.0 4 38.156 39.0 38.0 40.0 35.0 40.0 5 38.16025 39.0 38.0 40.0 35.0 40.0 6 38.249 39.0 38.0 40.0 35.0 40.0 7 38.116 39.0 38.0 40.0 35.0 40.0 8 38.10825 39.0 38.0 40.0 35.0 40.0 9 38.101 39.0 38.0 40.0 35.0 40.0 10 37.9575 39.0 38.0 40.0 33.0 40.0 11 37.9105 39.0 38.0 40.0 33.0 40.0 12 37.833 39.0 38.0 40.0 33.0 40.0 13 37.78925 39.0 38.0 40.0 33.0 40.0 14 37.754 39.0 38.0 40.0 33.0 40.0 15 37.6755 39.0 38.0 40.0 33.0 40.0 16 37.7455 39.0 38.0 40.0 33.0 40.0 17 37.70825 39.0 38.0 40.0 33.0 40.0 18 37.57975 39.0 38.0 40.0 33.0 40.0 19 37.4835 39.0 38.0 40.0 33.0 40.0 20 37.4945 39.0 38.0 40.0 33.0 40.0 21 37.3775 39.0 38.0 40.0 33.0 40.0 22 37.24525 39.0 38.0 40.0 33.0 40.0 23 37.21375 39.0 37.0 40.0 33.0 40.0 24 37.1795 39.0 37.0 40.0 33.0 40.0 25 37.07925 39.0 37.0 40.0 32.0 40.0 26 37.05875 39.0 37.0 40.0 33.0 40.0 27 36.941 39.0 37.0 40.0 32.0 40.0 28 36.89925 39.0 36.0 40.0 32.0 40.0 29 36.698 39.0 36.0 40.0 31.0 40.0 30 36.58925 39.0 36.0 40.0 31.0 40.0 31 36.30175 39.0 36.0 40.0 30.0 40.0 32 36.157 39.0 36.0 40.0 30.0 40.0 33 36.24425 39.0 36.0 40.0 30.0 40.0 34 36.0485 39.0 35.0 40.0 29.0 40.0 35 35.9895 39.0 35.0 40.0 29.0 40.0 36 36.08925 39.0 36.0 40.0 30.0 40.0 37 35.9575 39.0 35.0 40.0 30.0 40.0 38 35.8855 39.0 35.0 40.0 30.0 40.0 39 35.73375 38.0 35.0 40.0 29.0 40.0 40 35.669 38.0 35.0 40.0 29.0 40.0 41 35.53225 38.0 35.0 40.0 29.0 40.0 42 35.46275 38.0 35.0 39.0 29.0 40.0 43 35.28475 38.0 35.0 39.0 29.0 40.0 44 35.1175 38.0 35.0 39.0 29.0 40.0 45 34.9505 38.0 35.0 39.0 28.0 40.0 46 35.09375 38.0 35.0 39.0 29.0 40.0 47 34.9795 38.0 35.0 39.0 29.0 40.0 48 34.747 38.0 34.0 39.0 29.0 40.0 49 34.57825 38.0 34.0 39.0 28.0 40.0 50 34.43475 38.0 34.0 39.0 28.0 40.0 51 34.2425 37.0 34.0 39.0 27.0 40.0 52 34.05025 37.0 33.0 39.0 27.0 40.0 53 33.92525 37.0 33.0 39.0 27.0 39.0 54 33.6285 36.0 33.0 39.0 26.0 39.0 55 33.467 36.0 33.0 39.0 25.0 39.0 56 33.10375 36.0 33.0 38.0 24.0 39.0 57 32.867 36.0 33.0 38.0 23.0 39.0 58 32.6985 36.0 33.0 38.0 23.0 39.0 59 32.371 36.0 32.0 38.0 22.0 39.0 60 32.2335 36.0 32.0 38.0 20.0 39.0 61 32.00925 36.0 32.0 38.0 19.0 39.0 62 31.82025 35.0 32.0 38.0 17.0 39.0 63 31.51525 35.0 32.0 38.0 14.0 39.0 64 31.23175 35.0 31.0 38.0 7.0 39.0 65 31.0285 35.0 31.0 37.0 2.0 38.0 66 30.52775 35.0 31.0 37.0 2.0 38.0 67 30.191 34.0 31.0 36.0 2.0 38.0 68 29.80925 34.0 29.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 1.0 7 2.0 8 7.0 9 9.0 10 8.0 11 11.0 12 11.0 13 11.0 14 9.0 15 11.0 16 14.0 17 15.0 18 13.0 19 16.0 20 19.0 21 19.0 22 24.0 23 26.0 24 26.0 25 25.0 26 24.0 27 44.0 28 41.0 29 46.0 30 79.0 31 83.0 32 104.0 33 124.0 34 161.0 35 257.0 36 349.0 37 643.0 38 1088.0 39 678.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.800000000000004 16.45 13.825000000000001 41.925000000000004 2 21.461071789686553 22.093023255813954 36.93124368048534 19.514661274014156 3 21.85 27.275 27.325 23.549999999999997 4 24.925 32.0 22.15 20.925 5 25.25 35.425000000000004 22.55 16.775000000000002 6 18.025 39.275 23.875 18.825 7 15.950000000000001 17.974999999999998 44.95 21.125 8 18.475 24.175 30.9 26.450000000000003 9 20.724999999999998 23.3 32.775 23.200000000000003 10 19.75 39.1 23.9 17.25 11 24.7 28.175 23.200000000000003 23.925 12 20.825 25.674999999999997 29.125 24.375 13 19.975 28.749999999999996 30.15 21.125 14 21.05 27.35 29.275000000000002 22.325 15 19.900000000000002 28.475 28.775000000000002 22.85 16 22.525000000000002 27.925 27.900000000000002 21.65 17 21.575 28.825 27.975 21.625 18 21.825 28.299999999999997 28.7 21.175 19 21.75 28.499999999999996 28.349999999999998 21.4 20 22.325 28.499999999999996 27.800000000000004 21.375 21 21.224999999999998 29.65 27.150000000000002 21.975 22 21.875 28.125 27.900000000000002 22.1 23 22.1 28.599999999999998 28.425 20.875 24 20.825 28.549999999999997 28.15 22.475 25 21.625 27.725 28.325 22.325 26 21.2 28.125 28.475 22.2 27 20.8 28.325 28.825 22.05 28 20.925 28.449999999999996 28.575 22.05 29 20.474999999999998 28.599999999999998 28.275 22.650000000000002 30 21.375 28.7 28.225 21.7 31 20.375 28.925 28.050000000000004 22.650000000000002 32 21.8 29.65 27.55 21.0 33 22.6 27.825 28.65 20.925 34 22.45 29.049999999999997 27.3 21.2 35 21.775 28.975 27.224999999999998 22.025 36 21.6 28.349999999999998 28.349999999999998 21.7 37 21.4 28.499999999999996 28.025 22.075 38 21.875 28.175 28.249999999999996 21.7 39 21.325 28.000000000000004 27.85 22.825 40 22.325 27.575 29.325000000000003 20.775 41 22.475 28.375 27.625 21.525 42 21.349999999999998 28.925 27.224999999999998 22.5 43 22.325 28.625 27.950000000000003 21.099999999999998 44 22.0 28.999999999999996 27.375 21.625 45 21.475 29.175 26.674999999999997 22.675 46 20.7 28.999999999999996 28.9 21.4 47 22.3 28.549999999999997 27.450000000000003 21.7 48 21.625 27.525 28.249999999999996 22.6 49 20.525 29.525000000000002 28.7 21.25 50 22.175 27.55 28.425 21.85 51 21.7 28.449999999999996 27.700000000000003 22.15 52 20.974999999999998 28.025 28.799999999999997 22.2 53 21.625 29.025000000000002 28.249999999999996 21.099999999999998 54 21.0 28.575 28.275 22.15 55 21.75 28.199999999999996 27.3 22.75 56 22.75 28.625 28.425 20.200000000000003 57 21.9 27.925 26.825 23.35 58 21.425 27.975 27.625 22.975 59 21.05 28.425 29.325000000000003 21.2 60 22.05 28.549999999999997 26.700000000000003 22.7 61 22.125 28.375 28.050000000000004 21.45 62 21.475 28.849999999999998 27.825 21.85 63 21.45 28.225 28.000000000000004 22.325 64 21.525 28.725 28.375 21.375 65 21.775 28.575 28.075 21.575 66 22.775000000000002 29.125 27.425 20.674999999999997 67 21.975 27.500000000000004 28.1 22.425 68 22.0 28.199999999999996 27.175 22.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.5 3 1.0 4 0.5 5 0.5 6 1.0 7 0.5 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 1.0 19 2.0 20 2.5 21 4.5 22 6.0 23 8.0 24 7.5 25 5.0 26 11.0 27 20.5 28 24.0 29 29.0 30 42.5 31 51.0 32 64.0 33 94.0 34 111.0 35 129.0 36 162.5 37 178.0 38 206.5 39 273.5 40 312.0 41 312.0 42 344.0 43 370.0 44 364.0 45 354.5 46 352.0 47 359.0 48 303.5 49 235.5 50 223.0 51 201.0 52 147.0 53 115.0 54 91.5 55 64.0 56 60.0 57 49.5 58 32.5 59 26.0 60 23.5 61 19.5 62 18.0 63 12.5 64 6.5 65 5.0 66 4.0 67 3.5 68 3.5 69 4.0 70 2.5 71 1.0 72 1.0 73 0.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.0999999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352456 spots for SRR3207764.sra Written 352456 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra Read 352442 spots for SRR3207764.sra Written 352442 spots for SRR3207764.sra SRR ids: ['SRR3207764.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ivzvp84n SRR3207764.sra spots: 7048854 blocks: [[1, 352442], [352443, 704884], [704885, 1057326], [1057327, 1409768], [1409769, 1762210], [1762211, 2114652], [2114653, 2467094], [2467095, 2819536], [2819537, 3171978], [3171979, 3524420], [3524421, 3876862], [3876863, 4229304], [4229305, 4581746], [4581747, 4934188], [4934189, 5286630], [5286631, 5639072], [5639073, 5991514], [5991515, 6343956], [6343957, 6696398], [6696399, 7048854]] SRR3207764 file size 1487060 SRR3207764 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207764 SRR3207764_1.fastq Input file: SRR3207764_1.fastq trimmed: SRR3207764-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:13:06 2025 >> started Mon Feb 10 21:13:10 2025 >> done (3.363s) 7048854 reads processed; of these: 17067 ( 0.24%) short reads filtered out after trimming by size control 16888 ( 0.24%) empty reads filtered out after trimming by size control 7014899 (99.52%) reads available; of these: 500178 ( 7.13%) trimmed reads available after processing 6514721 (92.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1483 0.02% 19 2206 0.03% 20 4031 0.06% 21 1204 0.02% 22 1600 0.02% 23 2523 0.04% 24 4144 0.06% 25 7524 0.11% 26 1800 0.03% 27 2299 0.03% 28 3268 0.05% 29 5143 0.07% 30 9031 0.13% 31 2262 0.03% 32 2818 0.04% 33 3484 0.05% 34 5379 0.08% 35 9283 0.13% 36 2303 0.03% 37 3039 0.04% 38 4406 0.06% 39 7204 0.10% 40 12486 0.18% 41 3375 0.05% 42 3318 0.05% 43 4929 0.07% 44 8222 0.12% 45 13937 0.20% 46 3420 0.05% 47 4598 0.07% 48 6917 0.10% 49 11905 0.17% 50 21766 0.31% 51 4727 0.07% 52 6169 0.09% 53 9520 0.14% 54 16418 0.23% 55 31121 0.44% 56 6426 0.09% 57 8452 0.12% 58 12769 0.18% 59 23201 0.33% 60 46111 0.66% 61 8230 0.12% 62 10942 0.16% 63 16195 0.23% 64 28982 0.41% 65 53398 0.76% 66 9863 0.14% 67 26347 0.38% 68 6514721 92.87% 7014899 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=6.41 fanout-score-rank=9 prefix-density=0.07 prefix-fanout=4.3 sequence=CTGCAGCTGCAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=167.64 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=18.9 sequence=TTCTTCTTCTTC Started job on | Feb 10 21:13:22 Started mapping on | Feb 10 21:13:22 Finished on | Feb 10 21:13:30 Mapping speed, Million of reads per hour | 3156.70 Number of input reads | 7014899 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 6697362 Uniquely mapped reads % | 95.47% Average mapped length | 66.87 Number of splices: Total | 1272416 Number of splices: Annotated (sjdb) | 1249366 Number of splices: GT/AG | 1253945 Number of splices: GC/AG | 15585 Number of splices: AT/AC | 1437 Number of splices: Non-canonical | 1449 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 205852 % of reads mapped to multiple loci | 2.93% Number of reads mapped to too many loci | 67744 % of reads mapped to too many loci | 0.97% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.54% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 111685 111685 111685 N_multimapping 205852 205852 205852 N_noFeature 325847 3450967 3525768 N_ambiguous 67879 10561 10938 UnstrandedReadsAssigned:6303636 PositiveStrandReadsAssigned:3235834 NegativeStrandReadsAssigned:3160656 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207764 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207764-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,014,899 reads, 6,480,257 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,035 rounds 52401 SRR3207764.ke.tsv 34699 SRR3207764.se.tsv 87100 total ==> SRR3207764.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 197 24.3321 Potri.005G024800.1.v4.1 1035 936 24 6.07748 Potri.004G059700.1.v4.1 961 862 4 1.09987 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 87.2354 7.27028 Potri.016G087400.1.v4.1 270 171 216 299.396 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 28.5066 4.03625 Potri.012G127500.1.v4.1 977 878 264 71.2685 ==> SRR3207764.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1032 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 141 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207764 completed mapping pipeline successfully