Starting /dee2/code/volunteer_pipeline.sh SRR3207765 current disk space = 3056060096512 free memory = 1200339044 SRR3207765 SRAfilesize f8fce18581b04254f8de646429c170b7 SRR3207765.sra SRR3207765.sra file validated SRR3207765 is single end SRR3207765 is conventional basespace SRR3207765 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207765_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.31675 40.0 38.0 40.0 35.0 40.0 2 37.8875 39.0 38.0 40.0 35.0 40.0 3 38.09875 39.0 38.0 40.0 35.0 40.0 4 38.12375 39.0 38.0 40.0 35.0 40.0 5 38.1125 39.0 38.0 40.0 35.0 40.0 6 38.1325 39.0 38.0 40.0 35.0 40.0 7 38.15425 39.0 38.0 40.0 35.0 40.0 8 38.028 39.0 38.0 40.0 35.0 40.0 9 38.017 39.0 38.0 40.0 35.0 40.0 10 37.89925 39.0 38.0 40.0 34.0 40.0 11 37.94125 39.0 38.0 40.0 34.0 40.0 12 37.83475 39.0 38.0 40.0 34.0 40.0 13 37.76525 39.0 38.0 40.0 33.0 40.0 14 37.72475 39.0 38.0 40.0 33.0 40.0 15 37.71375 39.0 38.0 40.0 33.0 40.0 16 37.71525 39.0 38.0 40.0 33.0 40.0 17 37.64625 39.0 38.0 40.0 33.0 40.0 18 37.5695 39.0 38.0 40.0 33.0 40.0 19 37.4965 39.0 38.0 40.0 33.0 40.0 20 37.4785 39.0 38.0 40.0 33.0 40.0 21 37.37625 39.0 38.0 40.0 33.0 40.0 22 37.4255 39.0 38.0 40.0 33.0 40.0 23 37.31075 39.0 37.0 40.0 33.0 40.0 24 37.2645 39.0 37.0 40.0 32.0 40.0 25 37.212 39.0 37.0 40.0 33.0 40.0 26 37.2335 39.0 37.0 40.0 33.0 40.0 27 37.123 39.0 37.0 40.0 33.0 40.0 28 37.074 39.0 36.0 40.0 32.0 40.0 29 36.90925 39.0 36.0 40.0 31.0 40.0 30 36.81375 39.0 36.0 40.0 31.0 40.0 31 36.579 39.0 36.0 40.0 31.0 40.0 32 36.40725 39.0 36.0 40.0 31.0 40.0 33 36.5255 39.0 36.0 40.0 31.0 40.0 34 36.39075 39.0 36.0 40.0 31.0 40.0 35 36.265 39.0 36.0 40.0 30.0 40.0 36 36.47875 39.0 36.0 40.0 32.0 40.0 37 36.34825 39.0 36.0 40.0 31.0 40.0 38 36.1915 39.0 36.0 40.0 30.0 40.0 39 36.026 39.0 35.0 40.0 30.0 40.0 40 35.879 39.0 35.0 40.0 30.0 40.0 41 35.85325 38.0 35.0 40.0 30.0 40.0 42 35.7285 38.0 35.0 40.0 29.0 40.0 43 35.5405 38.0 35.0 39.0 30.0 40.0 44 35.48875 38.0 35.0 39.0 29.0 40.0 45 35.35425 38.0 35.0 39.0 29.0 40.0 46 35.33125 38.0 35.0 39.0 29.0 40.0 47 35.2115 38.0 35.0 39.0 29.0 40.0 48 35.079 38.0 35.0 39.0 29.0 40.0 49 34.902 38.0 35.0 39.0 29.0 40.0 50 34.6815 38.0 34.0 39.0 28.0 40.0 51 34.56525 38.0 34.0 39.0 28.0 40.0 52 34.4025 38.0 34.0 39.0 28.0 40.0 53 34.261 37.0 34.0 39.0 27.0 40.0 54 34.077 37.0 33.0 39.0 27.0 39.0 55 33.9285 36.0 33.0 39.0 27.0 39.0 56 33.615 36.0 33.0 39.0 26.0 39.0 57 33.4375 36.0 33.0 38.0 25.0 39.0 58 33.19575 36.0 33.0 38.0 25.0 39.0 59 33.02675 36.0 33.0 38.0 25.0 39.0 60 32.746 36.0 33.0 38.0 23.0 39.0 61 32.5585 36.0 33.0 38.0 22.0 39.0 62 32.363 36.0 33.0 38.0 22.0 39.0 63 32.1125 36.0 32.0 38.0 21.0 39.0 64 31.83925 35.0 32.0 38.0 20.0 39.0 65 31.611 35.0 32.0 38.0 18.0 39.0 66 31.1175 35.0 31.0 38.0 2.0 39.0 67 30.903 35.0 31.0 37.0 2.0 38.0 68 30.4275 34.0 30.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 2.0 5 4.0 6 1.0 7 3.0 8 1.0 9 6.0 10 4.0 11 4.0 12 8.0 13 7.0 14 17.0 15 14.0 16 10.0 17 11.0 18 19.0 19 9.0 20 18.0 21 13.0 22 23.0 23 22.0 24 24.0 25 19.0 26 28.0 27 31.0 28 40.0 29 51.0 30 65.0 31 54.0 32 98.0 33 142.0 34 174.0 35 238.0 36 371.0 37 637.0 38 1067.0 39 759.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.182045511377847 15.453863465866466 13.85346336584146 42.51062765691423 2 18.803634528016154 25.239777889954567 39.44977284199899 16.506814740030286 3 20.275000000000002 28.199999999999996 27.05 24.474999999999998 4 22.925 35.199999999999996 20.424999999999997 21.45 5 23.150000000000002 36.1 23.575 17.175 6 16.150000000000002 39.725 24.675 19.45 7 16.22905726431608 18.179544886221557 44.96124031007752 20.630157539384847 8 17.8 22.125 32.25 27.825 9 19.1 23.175 32.625 25.1 10 19.525000000000002 39.45 23.974999999999998 17.05 11 24.975 28.199999999999996 21.675 25.15 12 20.150000000000002 24.349999999999998 30.225 25.275 13 18.6 28.95 32.45 20.0 14 21.0 27.975 30.2 20.825 15 21.5 27.05 29.549999999999997 21.9 16 21.85 28.7 27.55 21.9 17 21.4 27.975 28.599999999999998 22.025 18 20.925 28.225 28.1 22.75 19 22.325 28.325 28.15 21.2 20 22.125 27.875 28.225 21.775 21 20.25 28.199999999999996 29.525000000000002 22.025 22 21.675 29.099999999999998 28.175 21.05 23 20.95 29.875 27.750000000000004 21.425 24 21.25 29.65 26.75 22.35 25 20.424999999999997 28.749999999999996 28.000000000000004 22.825 26 22.15 28.525 28.975 20.349999999999998 27 20.575 27.950000000000003 28.725 22.75 28 20.275000000000002 29.299999999999997 29.175 21.25 29 21.575 29.95 28.000000000000004 20.474999999999998 30 21.0 28.549999999999997 28.1 22.35 31 21.175 28.849999999999998 27.474999999999998 22.5 32 21.4 29.349999999999998 27.500000000000004 21.75 33 20.150000000000002 28.95 29.025000000000002 21.875 34 21.325 28.525 28.549999999999997 21.6 35 22.5 28.4 27.175 21.925 36 21.675 28.375 28.799999999999997 21.15 37 21.25 28.199999999999996 28.425 22.125 38 22.05 29.525000000000002 27.0 21.425 39 21.375 29.375 27.750000000000004 21.5 40 20.7 28.775000000000002 27.975 22.55 41 21.775 28.799999999999997 27.700000000000003 21.725 42 22.325 28.249999999999996 27.675 21.75 43 21.15 29.4 28.575 20.875 44 22.05 28.525 28.425 21.0 45 21.425 28.7 28.249999999999996 21.625 46 21.625 27.575 28.075 22.725 47 20.95 29.825000000000003 27.775 21.45 48 21.675 28.499999999999996 28.199999999999996 21.625 49 20.3 28.449999999999996 28.925 22.325 50 22.400000000000002 28.025 28.000000000000004 21.575 51 21.65 28.299999999999997 28.375 21.675 52 22.725 27.400000000000002 26.974999999999998 22.900000000000002 53 21.65 28.299999999999997 28.749999999999996 21.3 54 21.875 27.750000000000004 27.925 22.45 55 20.95 29.15 28.499999999999996 21.4 56 21.875 28.475 28.1 21.55 57 20.875 28.475 28.499999999999996 22.15 58 21.4 29.425 28.199999999999996 20.974999999999998 59 21.075 29.625 28.075 21.224999999999998 60 21.375 29.825000000000003 29.175 19.625 61 22.125 28.375 27.625 21.875 62 21.075 29.625 27.950000000000003 21.349999999999998 63 22.25 27.975 27.85 21.925 64 22.5 26.875 29.15 21.475 65 21.3 29.575000000000003 27.950000000000003 21.175 66 21.975 28.849999999999998 29.049999999999997 20.125 67 21.075 28.549999999999997 27.775 22.6 68 22.35 28.499999999999996 27.325 21.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 2.0 21 5.5 22 8.0 23 8.5 24 14.0 25 19.0 26 20.5 27 23.5 28 25.0 29 39.0 30 58.0 31 63.0 32 82.5 33 105.0 34 108.0 35 119.0 36 170.5 37 211.0 38 238.0 39 280.5 40 314.5 41 333.0 42 338.0 43 350.5 44 358.0 45 357.0 46 332.0 47 308.0 48 277.5 49 231.0 50 215.0 51 188.0 52 137.5 53 114.0 54 102.5 55 71.0 56 51.0 57 44.5 58 34.0 59 30.0 60 22.0 61 9.0 62 4.0 63 4.5 64 5.5 65 4.0 66 2.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 1.0 75 2.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.95 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341430 spots for SRR3207765.sra Written 341430 spots for SRR3207765.sra Read 341439 spots for SRR3207765.sra Written 341439 spots for SRR3207765.sra SRR ids: ['SRR3207765.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_np7vtr0c SRR3207765.sra spots: 6828609 blocks: [[1, 341430], [341431, 682860], [682861, 1024290], [1024291, 1365720], [1365721, 1707150], [1707151, 2048580], [2048581, 2390010], [2390011, 2731440], [2731441, 3072870], [3072871, 3414300], [3414301, 3755730], [3755731, 4097160], [4097161, 4438590], [4438591, 4780020], [4780021, 5121450], [5121451, 5462880], [5462881, 5804310], [5804311, 6145740], [6145741, 6487170], [6487171, 6828609]] SRR3207765 file size 1440571 SRR3207765 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207765 SRR3207765_1.fastq Input file: SRR3207765_1.fastq trimmed: SRR3207765-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:21:01 2025 >> started Mon Feb 10 20:21:04 2025 >> done (3.397s) 6828609 reads processed; of these: 16303 ( 0.24%) short reads filtered out after trimming by size control 8606 ( 0.13%) empty reads filtered out after trimming by size control 6803700 (99.64%) reads available; of these: 460128 ( 6.76%) trimmed reads available after processing 6343572 (93.24%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1349 0.02% 19 2075 0.03% 20 3671 0.05% 21 1197 0.02% 22 1580 0.02% 23 2255 0.03% 24 3837 0.06% 25 6977 0.10% 26 1603 0.02% 27 2109 0.03% 28 3095 0.05% 29 4884 0.07% 30 8299 0.12% 31 2171 0.03% 32 2605 0.04% 33 3162 0.05% 34 5129 0.08% 35 8726 0.13% 36 2236 0.03% 37 2812 0.04% 38 3992 0.06% 39 6563 0.10% 40 11593 0.17% 41 3078 0.05% 42 3129 0.05% 43 4440 0.07% 44 7471 0.11% 45 12905 0.19% 46 3238 0.05% 47 4193 0.06% 48 6328 0.09% 49 11131 0.16% 50 19838 0.29% 51 4197 0.06% 52 5661 0.08% 53 8466 0.12% 54 15095 0.22% 55 28748 0.42% 56 5732 0.08% 57 7684 0.11% 58 11615 0.17% 59 21303 0.31% 60 42432 0.62% 61 7393 0.11% 62 9782 0.14% 63 14939 0.22% 64 26195 0.39% 65 49904 0.73% 66 8649 0.13% 67 24662 0.36% 68 6343572 93.24% 6803700 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=38 prefix-density=0.04 prefix-fanout=2.0 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=5 fanout-score=175.84 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=21.6 sequence=TTCTTCTTCTTT Started job on | Feb 10 20:21:22 Started mapping on | Feb 10 20:21:23 Finished on | Feb 10 20:21:30 Mapping speed, Million of reads per hour | 3499.05 Number of input reads | 6803700 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 6509876 Uniquely mapped reads % | 95.68% Average mapped length | 66.85 Number of splices: Total | 1224409 Number of splices: Annotated (sjdb) | 1203223 Number of splices: GT/AG | 1206458 Number of splices: GC/AG | 14866 Number of splices: AT/AC | 1274 Number of splices: Non-canonical | 1811 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.70 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 205429 % of reads mapped to multiple loci | 3.02% Number of reads mapped to too many loci | 57692 % of reads mapped to too many loci | 0.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.43% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 88395 88395 88395 N_multimapping 205429 205429 205429 N_noFeature 327728 3391220 3401376 N_ambiguous 64712 9803 9983 UnstrandedReadsAssigned:6117436 PositiveStrandReadsAssigned:3108853 NegativeStrandReadsAssigned:3098517 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207765 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207765-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,803,700 reads, 6,292,030 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52401 SRR3207765.ke.tsv 34699 SRR3207765.se.tsv 87100 total ==> SRR3207765.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 219 27.2439 Potri.005G024800.1.v4.1 1035 936 29 7.39642 Potri.004G059700.1.v4.1 961 862 7 1.93861 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 103.724 8.70659 Potri.016G087400.1.v4.1 270 171 197 275.023 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 33.6317 4.79615 Potri.012G127500.1.v4.1 977 878 689 187.337 ==> SRR3207765.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 627 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 148 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207765 completed mapping pipeline successfully