Starting /dee2/code/volunteer_pipeline.sh SRR3207766 current disk space = 3056159555584 free memory = 1441782116 SRR3207766 SRAfilesize d8d4213327344968cd6c19310e36b54a SRR3207766.sra SRR3207766.sra file validated SRR3207766 is single end SRR3207766 is conventional basespace SRR3207766 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207766_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.72525 40.0 39.0 40.0 36.0 40.0 2 38.4895 40.0 39.0 40.0 35.0 40.0 3 38.5185 40.0 39.0 40.0 35.0 40.0 4 38.535 40.0 39.0 40.0 35.0 40.0 5 38.46075 40.0 39.0 40.0 35.0 40.0 6 38.51025 40.0 39.0 40.0 35.0 40.0 7 38.4795 40.0 38.0 40.0 35.0 40.0 8 38.5075 40.0 39.0 40.0 35.0 40.0 9 38.402 40.0 38.0 40.0 35.0 40.0 10 38.3615 40.0 38.0 40.0 35.0 40.0 11 38.3245 40.0 38.0 40.0 35.0 40.0 12 38.2975 40.0 38.0 40.0 35.0 40.0 13 38.25875 40.0 38.0 40.0 35.0 40.0 14 38.187 40.0 38.0 40.0 35.0 40.0 15 38.17275 40.0 38.0 40.0 35.0 40.0 16 38.13275 40.0 38.0 40.0 35.0 40.0 17 38.1345 40.0 38.0 40.0 35.0 40.0 18 38.03825 40.0 38.0 40.0 35.0 40.0 19 37.976 39.0 38.0 40.0 34.0 40.0 20 37.97925 39.0 38.0 40.0 35.0 40.0 21 37.9785 39.0 38.0 40.0 35.0 40.0 22 37.92625 39.0 38.0 40.0 34.0 40.0 23 37.84625 39.0 38.0 40.0 33.0 40.0 24 37.79375 39.0 38.0 40.0 33.0 40.0 25 37.7985 39.0 38.0 40.0 33.0 40.0 26 37.58675 39.0 38.0 40.0 33.0 40.0 27 37.486 39.0 38.0 40.0 33.0 40.0 28 37.509 39.0 38.0 40.0 33.0 40.0 29 37.375 39.0 38.0 40.0 33.0 40.0 30 37.3165 39.0 38.0 40.0 33.0 40.0 31 37.1455 39.0 37.0 40.0 33.0 40.0 32 37.034 39.0 37.0 40.0 33.0 40.0 33 37.031 39.0 37.0 40.0 32.0 40.0 34 36.96025 39.0 37.0 40.0 32.0 40.0 35 36.93275 39.0 37.0 40.0 32.0 40.0 36 37.03175 39.0 37.0 40.0 33.0 40.0 37 36.912 39.0 37.0 40.0 33.0 40.0 38 36.7445 39.0 36.0 40.0 32.0 40.0 39 36.6595 39.0 36.0 40.0 32.0 40.0 40 36.55225 39.0 36.0 40.0 31.0 40.0 41 36.6335 39.0 36.0 40.0 32.0 40.0 42 36.49425 39.0 36.0 40.0 32.0 40.0 43 36.38575 39.0 36.0 40.0 31.0 40.0 44 36.34375 39.0 36.0 40.0 31.0 40.0 45 36.17975 39.0 36.0 40.0 31.0 40.0 46 36.21975 39.0 36.0 40.0 31.0 40.0 47 36.061 39.0 36.0 40.0 31.0 40.0 48 35.9305 39.0 36.0 39.0 31.0 40.0 49 35.83075 38.0 36.0 39.0 31.0 40.0 50 35.64975 38.0 35.0 39.0 30.0 40.0 51 35.53025 38.0 35.0 39.0 30.0 40.0 52 35.4025 38.0 35.0 39.0 30.0 40.0 53 35.23275 38.0 35.0 39.0 30.0 40.0 54 35.05875 38.0 35.0 39.0 29.0 40.0 55 34.88775 38.0 35.0 39.0 29.0 40.0 56 34.73975 38.0 35.0 39.0 29.0 40.0 57 34.50575 38.0 34.0 39.0 28.0 40.0 58 34.26375 37.0 34.0 39.0 27.0 40.0 59 34.21175 37.0 34.0 39.0 28.0 40.0 60 33.9545 37.0 33.0 39.0 27.0 39.0 61 33.582 36.0 33.0 39.0 26.0 39.0 62 33.39925 36.0 33.0 39.0 25.0 39.0 63 33.25675 36.0 33.0 38.0 25.0 39.0 64 33.0035 36.0 33.0 38.0 24.0 39.0 65 32.7335 36.0 33.0 38.0 23.0 39.0 66 32.448 36.0 33.0 38.0 21.0 39.0 67 32.247 36.0 33.0 38.0 21.0 39.0 68 31.77475 35.0 31.0 38.0 19.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 2.0 6 2.0 7 2.0 8 4.0 9 4.0 10 3.0 11 5.0 12 4.0 13 9.0 14 11.0 15 9.0 16 4.0 17 12.0 18 11.0 19 12.0 20 7.0 21 13.0 22 11.0 23 20.0 24 19.0 25 20.0 26 24.0 27 31.0 28 26.0 29 47.0 30 50.0 31 63.0 32 65.0 33 96.0 34 144.0 35 177.0 36 295.0 37 555.0 38 1045.0 39 1194.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.6 15.675 13.600000000000001 43.125 2 19.62897969415894 24.592629731762347 38.0045124091251 17.773878164953622 3 21.3 26.75 28.15 23.799999999999997 4 23.3 32.95 22.2 21.55 5 25.174999999999997 35.9 21.875 17.05 6 17.474999999999998 39.0 24.75 18.775 7 16.23311655827914 18.009004502251123 44.772386193096544 20.985492746373186 8 18.625 22.85 31.25 27.275 9 19.975 22.675 31.95 25.4 10 19.6 37.974999999999994 24.725 17.7 11 24.575 28.625 22.400000000000002 24.4 12 21.175 24.2 31.1 23.525 13 19.925 28.725 30.7 20.65 14 20.1 28.975 29.875 21.05 15 21.025 27.55 28.325 23.1 16 21.2 28.65 27.150000000000002 23.0 17 22.075 29.125 27.075 21.725 18 21.9 27.975 27.625 22.5 19 21.224999999999998 29.725 26.625 22.425 20 21.45 28.1 27.575 22.875 21 21.099999999999998 27.625 29.4 21.875 22 21.175 28.499999999999996 27.474999999999998 22.85 23 21.325 28.549999999999997 28.375 21.75 24 21.825 30.2 27.725 20.25 25 21.775 27.250000000000004 28.375 22.6 26 20.599999999999998 29.975 27.474999999999998 21.95 27 21.48574287143572 29.214607303651825 27.41370685342671 21.885942971485743 28 21.635817908954476 29.264632316158078 27.163581790895446 21.935967983991997 29 21.75 27.675 29.349999999999998 21.224999999999998 30 20.810405202601302 29.739869934967484 26.863431715857928 22.586293146573286 31 21.85 27.525 27.025 23.599999999999998 32 20.275000000000002 29.775000000000002 27.250000000000004 22.7 33 21.425 27.950000000000003 27.500000000000004 23.125 34 22.275 28.249999999999996 27.725 21.75 35 22.425 28.849999999999998 26.950000000000003 21.775 36 21.7 27.775 27.875 22.650000000000002 37 22.15 28.375 27.825 21.65 38 20.875 28.7 28.525 21.9 39 20.0 28.325 30.2 21.475 40 21.875 28.375 28.299999999999997 21.45 41 21.6 28.549999999999997 28.549999999999997 21.3 42 20.200000000000003 28.425 28.775000000000002 22.6 43 22.025 28.075 28.425 21.475 44 20.525 30.175 27.700000000000003 21.6 45 21.55 27.125 29.4 21.925 46 21.45 28.199999999999996 27.700000000000003 22.650000000000002 47 21.575 28.375 28.425 21.625 48 20.424999999999997 27.700000000000003 29.125 22.75 49 21.425 28.625 27.325 22.625 50 23.200000000000003 28.95 28.025 19.825 51 21.4 27.625 28.375 22.6 52 21.4 28.175 27.450000000000003 22.975 53 21.025 28.275 28.549999999999997 22.15 54 22.325 26.674999999999997 28.1 22.900000000000002 55 21.125 28.299999999999997 28.725 21.85 56 22.375 27.6 26.625 23.400000000000002 57 20.875 29.375 28.599999999999998 21.15 58 22.05 28.125 27.925 21.9 59 21.775 29.125 27.250000000000004 21.85 60 21.425 26.85 29.075 22.650000000000002 61 21.575 28.4 27.0 23.025000000000002 62 21.475 28.275 28.725 21.525 63 21.375 27.950000000000003 27.950000000000003 22.725 64 22.650000000000002 28.000000000000004 27.450000000000003 21.9 65 22.05 29.525000000000002 26.700000000000003 21.725 66 21.275 29.5 28.050000000000004 21.175 67 22.8 26.825 28.075 22.3 68 21.775 28.575 28.599999999999998 21.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 1.5 21 3.5 22 4.0 23 6.5 24 10.0 25 11.0 26 11.0 27 26.0 28 41.0 29 37.5 30 47.0 31 60.0 32 78.0 33 103.5 34 111.0 35 134.5 36 178.5 37 199.0 38 212.5 39 246.5 40 291.0 41 315.0 42 340.0 43 353.0 44 341.0 45 351.0 46 334.5 47 308.0 48 295.5 49 244.5 50 206.0 51 193.0 52 152.5 53 125.0 54 106.5 55 72.0 56 56.0 57 52.0 58 38.0 59 28.0 60 22.5 61 12.0 62 7.0 63 8.5 64 7.5 65 5.0 66 5.0 67 6.5 68 5.5 69 3.0 70 2.0 71 1.5 72 2.0 73 2.0 74 1.0 75 0.0 76 0.5 77 1.0 78 1.0 79 0.5 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.05 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.05 28 0.05 29 0.0 30 0.05 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.698568198945 99.225 2 0.27631248430042704 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025119316754584273 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTGAAAAA 9 0.22499999999999998 TruSeq Adapter, Index 9 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.1 0.0 0.0 0.0 0.0 22 0.1 0.0 0.0 0.0 0.0 23 0.1 0.0 0.0 0.0 0.0 24 0.1 0.0 0.0 0.0 0.0 25 0.1 0.0 0.0 0.0 0.0 26 0.1 0.0 0.0 0.0 0.0 27 0.1 0.0 0.0 0.0 0.0 28 0.1 0.0 0.0 0.0 0.0 29 0.1 0.0 0.0 0.0 0.0 30 0.1 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.1 0.0 0.0 0.0 0.0 34 0.1 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 39 0.1 0.0 0.0 0.0 0.0 40 0.1 0.0 0.0 0.0 0.0 41 0.1 0.0 0.0 0.0 0.0 42 0.1 0.0 0.0 0.0 0.0 43 0.1 0.0 0.0 0.0 0.0 44 0.1 0.0 0.0 0.0 0.0 45 0.1 0.0 0.0 0.0 0.0 46 0.1 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242683 spots for SRR3207766.sra Written 242683 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra Read 242664 spots for SRR3207766.sra Written 242664 spots for SRR3207766.sra SRR ids: ['SRR3207766.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rckhffj2 SRR3207766.sra spots: 4853299 blocks: [[1, 242664], [242665, 485328], [485329, 727992], [727993, 970656], [970657, 1213320], [1213321, 1455984], [1455985, 1698648], [1698649, 1941312], [1941313, 2183976], [2183977, 2426640], [2426641, 2669304], [2669305, 2911968], [2911969, 3154632], [3154633, 3397296], [3397297, 3639960], [3639961, 3882624], [3882625, 4125288], [4125289, 4367952], [4367953, 4610616], [4610617, 4853299]] SRR3207766 file size 1023518 SRR3207766 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207766 SRR3207766_1.fastq Input file: SRR3207766_1.fastq trimmed: SRR3207766-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:17:38 2025 >> started Mon Feb 10 20:17:41 2025 >> done (3.423s) 4853299 reads processed; of these: 10226 ( 0.21%) short reads filtered out after trimming by size control 27241 ( 0.56%) empty reads filtered out after trimming by size control 4815832 (99.23%) reads available; of these: 315990 ( 6.56%) trimmed reads available after processing 4499842 (93.44%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 910 0.02% 19 1546 0.03% 20 9400 0.20% 21 806 0.02% 22 1028 0.02% 23 1522 0.03% 24 2521 0.05% 25 4858 0.10% 26 1163 0.02% 27 1397 0.03% 28 1938 0.04% 29 3178 0.07% 30 5572 0.12% 31 1422 0.03% 32 1752 0.04% 33 2098 0.04% 34 3407 0.07% 35 5831 0.12% 36 1413 0.03% 37 1848 0.04% 38 2622 0.05% 39 4547 0.09% 40 7605 0.16% 41 2082 0.04% 42 2016 0.04% 43 2961 0.06% 44 5022 0.10% 45 8632 0.18% 46 2102 0.04% 47 2754 0.06% 48 4120 0.09% 49 7416 0.15% 50 13623 0.28% 51 2894 0.06% 52 3760 0.08% 53 5889 0.12% 54 10100 0.21% 55 19502 0.40% 56 3776 0.08% 57 5133 0.11% 58 7594 0.16% 59 14017 0.29% 60 28984 0.60% 61 4851 0.10% 62 6549 0.14% 63 9767 0.20% 64 17850 0.37% 65 33330 0.69% 66 5926 0.12% 67 16956 0.35% 68 4499842 93.44% 4815832 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=34 prefix-density=0.04 prefix-fanout=2.0 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=4 fanout-score=158.28 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=20.2 sequence=TTCTTCTTCTTTT Started job on | Feb 10 20:18:00 Started mapping on | Feb 10 20:18:00 Finished on | Feb 10 20:18:06 Mapping speed, Million of reads per hour | 2889.50 Number of input reads | 4815832 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4547040 Uniquely mapped reads % | 94.42% Average mapped length | 66.95 Number of splices: Total | 851360 Number of splices: Annotated (sjdb) | 835868 Number of splices: GT/AG | 838934 Number of splices: GC/AG | 10210 Number of splices: AT/AC | 906 Number of splices: Non-canonical | 1310 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.01% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 155192 % of reads mapped to multiple loci | 3.22% Number of reads mapped to too many loci | 91346 % of reads mapped to too many loci | 1.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 113600 113600 113600 N_multimapping 155192 155192 155192 N_noFeature 243340 2371336 2388061 N_ambiguous 46571 7700 7945 UnstrandedReadsAssigned:4257129 PositiveStrandReadsAssigned:2168004 NegativeStrandReadsAssigned:2151034 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207766 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207766-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,815,832 reads, 4,428,249 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR3207766.ke.tsv 34699 SRR3207766.se.tsv 87100 total ==> SRR3207766.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 121 22.0247 Potri.005G024800.1.v4.1 1035 936 16 5.97095 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 93.8212 11.5231 Potri.016G087400.1.v4.1 270 171 163.623 334.231 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 22.5443 4.70414 Potri.012G127500.1.v4.1 977 878 330 131.286 ==> SRR3207766.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 644 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 85 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207766 completed mapping pipeline successfully