Starting /dee2/code/volunteer_pipeline.sh SRR3207767 current disk space = 3056104738816 free memory = 1297794088 SRR3207767 SRAfilesize 7f7927042b5f40475137e6e60466fb2c SRR3207767.sra SRR3207767.sra file validated SRR3207767 is single end SRR3207767 is conventional basespace SRR3207767 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207767_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.5935 40.0 38.0 40.0 36.0 40.0 2 38.3925 40.0 38.0 40.0 36.0 40.0 3 38.41225 40.0 38.0 40.0 35.0 40.0 4 38.438 40.0 38.0 40.0 36.0 40.0 5 38.4245 40.0 38.0 40.0 35.0 40.0 6 38.3695 40.0 38.0 40.0 35.0 40.0 7 38.3895 40.0 38.0 40.0 35.0 40.0 8 38.369 40.0 38.0 40.0 35.0 40.0 9 38.304 40.0 38.0 40.0 35.0 40.0 10 38.2345 40.0 38.0 40.0 35.0 40.0 11 38.288 40.0 38.0 40.0 35.0 40.0 12 38.20425 40.0 38.0 40.0 35.0 40.0 13 38.1625 40.0 38.0 40.0 35.0 40.0 14 38.1105 40.0 38.0 40.0 35.0 40.0 15 38.09475 40.0 38.0 40.0 35.0 40.0 16 38.0665 40.0 38.0 40.0 35.0 40.0 17 38.02275 39.0 38.0 40.0 35.0 40.0 18 37.912 39.0 38.0 40.0 34.0 40.0 19 37.9 39.0 38.0 40.0 33.0 40.0 20 37.87475 39.0 38.0 40.0 33.0 40.0 21 37.85875 39.0 38.0 40.0 34.0 40.0 22 37.7565 39.0 38.0 40.0 33.0 40.0 23 37.73475 39.0 38.0 40.0 33.0 40.0 24 37.689 39.0 38.0 40.0 33.0 40.0 25 37.56875 39.0 38.0 40.0 33.0 40.0 26 37.49725 39.0 38.0 40.0 33.0 40.0 27 37.342 39.0 38.0 40.0 33.0 40.0 28 37.306 39.0 37.0 40.0 33.0 40.0 29 37.2805 39.0 37.0 40.0 33.0 40.0 30 37.16525 39.0 37.0 40.0 33.0 40.0 31 37.21975 39.0 37.0 40.0 33.0 40.0 32 37.01975 39.0 36.0 40.0 33.0 40.0 33 37.11825 39.0 37.0 40.0 32.0 40.0 34 37.005 39.0 36.0 40.0 32.0 40.0 35 36.956 39.0 36.0 40.0 32.0 40.0 36 36.8705 39.0 36.0 40.0 32.0 40.0 37 36.86875 39.0 36.0 40.0 32.0 40.0 38 36.71125 39.0 36.0 40.0 31.0 40.0 39 36.605 39.0 36.0 40.0 31.0 40.0 40 36.47325 39.0 36.0 40.0 31.0 40.0 41 36.447 39.0 36.0 40.0 31.0 40.0 42 36.3365 39.0 36.0 40.0 31.0 40.0 43 36.25975 39.0 36.0 40.0 31.0 40.0 44 36.17275 39.0 36.0 40.0 31.0 40.0 45 36.04975 39.0 36.0 40.0 30.0 40.0 46 36.183 39.0 36.0 40.0 31.0 40.0 47 35.96425 39.0 36.0 39.0 30.0 40.0 48 35.82625 38.0 35.0 39.0 30.0 40.0 49 35.698 38.0 35.0 39.0 30.0 40.0 50 35.48525 38.0 35.0 39.0 29.0 40.0 51 35.47175 38.0 35.0 39.0 30.0 40.0 52 35.301 38.0 35.0 39.0 29.0 40.0 53 35.15575 38.0 35.0 39.0 30.0 40.0 54 34.8965 38.0 34.0 39.0 29.0 40.0 55 34.71425 38.0 35.0 39.0 29.0 40.0 56 34.60775 38.0 35.0 39.0 29.0 40.0 57 34.42525 37.0 34.0 39.0 28.0 40.0 58 34.25875 37.0 33.0 39.0 28.0 40.0 59 34.143 37.0 33.0 39.0 28.0 39.0 60 33.88525 36.0 33.0 39.0 27.0 39.0 61 33.59975 36.0 33.0 39.0 27.0 39.0 62 33.4135 36.0 33.0 38.0 26.0 39.0 63 33.1495 36.0 33.0 38.0 25.0 39.0 64 32.99825 36.0 33.0 38.0 25.0 39.0 65 32.75525 36.0 33.0 38.0 24.0 39.0 66 32.435 36.0 33.0 38.0 23.0 39.0 67 32.21825 36.0 32.0 38.0 23.0 39.0 68 31.68925 35.0 31.0 38.0 20.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 1.0 6 2.0 7 1.0 8 4.0 9 2.0 10 7.0 11 4.0 12 3.0 13 3.0 14 9.0 15 7.0 16 5.0 17 11.0 18 5.0 19 12.0 20 12.0 21 13.0 22 22.0 23 12.0 24 18.0 25 26.0 26 28.0 27 31.0 28 32.0 29 46.0 30 61.0 31 72.0 32 61.0 33 99.0 34 144.0 35 225.0 36 299.0 37 572.0 38 1051.0 39 1094.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.65816454113528 15.828957239309826 13.903475868967242 37.609402350587644 2 20.140456483571608 23.5766240280913 36.76950087785302 19.513418610484074 3 22.35 24.95 27.775 24.925 4 22.925 34.475 20.599999999999998 22.0 5 23.849999999999998 37.2 22.05 16.900000000000002 6 17.875 38.85 23.799999999999997 19.475 7 16.275000000000002 17.525 45.725 20.474999999999998 8 18.0 22.75 31.55 27.700000000000003 9 20.474999999999998 22.825 30.875000000000004 25.825 10 20.325 38.95 23.025000000000002 17.7 11 23.674999999999997 28.849999999999998 22.125 25.35 12 21.025 24.625 28.4 25.95 13 20.875 27.975 30.95 20.200000000000003 14 19.75 27.700000000000003 30.8 21.75 15 21.525 27.175 28.749999999999996 22.55 16 21.6 28.075 27.6 22.725 17 21.9 28.225 28.95 20.925 18 21.65 26.55 28.000000000000004 23.799999999999997 19 21.075 28.975 28.249999999999996 21.7 20 22.2 27.925 28.475 21.4 21 21.224999999999998 27.700000000000003 28.599999999999998 22.475 22 21.6 28.799999999999997 27.725 21.875 23 21.675 27.35 28.15 22.825 24 20.549999999999997 29.099999999999998 29.075 21.275 25 22.025 27.175 28.175 22.625 26 21.8 28.449999999999996 27.500000000000004 22.25 27 21.825 27.1 28.025 23.05 28 21.224999999999998 29.45 27.6 21.725 29 21.65 28.175 27.85 22.325 30 20.5 28.275 27.950000000000003 23.275000000000002 31 21.775 28.000000000000004 27.750000000000004 22.475 32 23.0 27.775 27.775 21.45 33 22.5 27.325 28.375 21.8 34 21.275 28.175 28.199999999999996 22.35 35 22.625 27.6 27.625 22.15 36 21.099999999999998 28.475 27.150000000000002 23.275000000000002 37 21.175 28.575 27.675 22.575 38 22.375 27.375 28.475 21.775 39 22.35 28.199999999999996 27.450000000000003 22.0 40 20.75 28.275 27.750000000000004 23.225 41 22.650000000000002 27.875 27.450000000000003 22.025 42 23.05 27.925 27.1 21.925 43 22.475 28.925 28.349999999999998 20.25 44 21.95 29.275000000000002 27.450000000000003 21.325 45 21.099999999999998 29.7 26.325 22.875 46 20.5 28.499999999999996 27.55 23.45 47 21.15 30.175 27.05 21.625 48 21.625 28.000000000000004 29.2 21.175 49 23.0 28.249999999999996 28.025 20.724999999999998 50 21.75 28.749999999999996 26.8 22.7 51 22.1 26.75 29.4 21.75 52 22.900000000000002 27.400000000000002 28.349999999999998 21.349999999999998 53 22.775000000000002 27.275 28.999999999999996 20.95 54 21.425 28.449999999999996 27.775 22.35 55 21.8 27.250000000000004 27.200000000000003 23.75 56 22.825 26.450000000000003 28.225 22.5 57 22.2 26.5 28.65 22.650000000000002 58 21.875 28.349999999999998 27.35 22.425 59 22.125 27.700000000000003 28.125 22.05 60 20.849999999999998 28.225 28.999999999999996 21.925 61 22.775000000000002 28.050000000000004 28.299999999999997 20.875 62 22.3 28.075 26.825 22.8 63 21.9 28.449999999999996 27.075 22.575 64 20.974999999999998 28.799999999999997 28.275 21.95 65 22.650000000000002 28.675 27.474999999999998 21.2 66 22.175 27.1 27.425 23.3 67 21.349999999999998 28.499999999999996 29.099999999999998 21.05 68 24.075 28.825 27.075 20.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 1.5 19 2.0 20 2.5 21 4.0 22 5.0 23 4.5 24 5.5 25 7.0 26 15.0 27 21.0 28 19.0 29 23.5 30 33.5 31 39.0 32 54.0 33 83.0 34 97.0 35 118.5 36 158.5 37 177.0 38 199.5 39 248.0 40 302.5 41 331.0 42 353.0 43 371.5 44 368.0 45 364.5 46 347.5 47 334.0 48 306.0 49 243.5 50 209.0 51 206.0 52 165.0 53 127.0 54 115.5 55 80.0 56 56.0 57 47.5 58 32.5 59 26.0 60 23.0 61 19.0 62 18.0 63 12.0 64 8.0 65 8.5 66 7.0 67 4.5 68 2.5 69 3.0 70 4.5 71 3.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra Read 236322 spots for SRR3207767.sra Written 236322 spots for SRR3207767.sra Read 236312 spots for SRR3207767.sra Written 236312 spots for SRR3207767.sra SRR ids: ['SRR3207767.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_se7eiqzk SRR3207767.sra spots: 4726250 blocks: [[1, 236312], [236313, 472624], [472625, 708936], [708937, 945248], [945249, 1181560], [1181561, 1417872], [1417873, 1654184], [1654185, 1890496], [1890497, 2126808], [2126809, 2363120], [2363121, 2599432], [2599433, 2835744], [2835745, 3072056], [3072057, 3308368], [3308369, 3544680], [3544681, 3780992], [3780993, 4017304], [4017305, 4253616], [4253617, 4489928], [4489929, 4726250]] SRR3207767 file size 996690 SRR3207767 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207767 SRR3207767_1.fastq Input file: SRR3207767_1.fastq trimmed: SRR3207767-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:21:57 2025 >> started Mon Feb 10 20:21:59 2025 >> done (2.068s) 4726250 reads processed; of these: 10191 ( 0.22%) short reads filtered out after trimming by size control 13987 ( 0.30%) empty reads filtered out after trimming by size control 4702072 (99.49%) reads available; of these: 298851 ( 6.36%) trimmed reads available after processing 4403221 (93.64%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 778 0.02% 19 1372 0.03% 20 2433 0.05% 21 665 0.01% 22 911 0.02% 23 1389 0.03% 24 2434 0.05% 25 4605 0.10% 26 1098 0.02% 27 1365 0.03% 28 1908 0.04% 29 3115 0.07% 30 5337 0.11% 31 1248 0.03% 32 1599 0.03% 33 2048 0.04% 34 3215 0.07% 35 5685 0.12% 36 1369 0.03% 37 1776 0.04% 38 2549 0.05% 39 4325 0.09% 40 7421 0.16% 41 1937 0.04% 42 1971 0.04% 43 2695 0.06% 44 4761 0.10% 45 8375 0.18% 46 2012 0.04% 47 2621 0.06% 48 4060 0.09% 49 7180 0.15% 50 13389 0.28% 51 2750 0.06% 52 3618 0.08% 53 5513 0.12% 54 9773 0.21% 55 18957 0.40% 56 3685 0.08% 57 4814 0.10% 58 7330 0.16% 59 13691 0.29% 60 28764 0.61% 61 4889 0.10% 62 6203 0.13% 63 9332 0.20% 64 17286 0.37% 65 32432 0.69% 66 5505 0.12% 67 16663 0.35% 68 4403221 93.64% 4702072 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=37 prefix-density=0.04 prefix-fanout=2.0 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=14 fanout-score=218.63 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=22.9 sequence=TTCTTCTTCTTC Started job on | Feb 10 20:22:12 Started mapping on | Feb 10 20:22:13 Finished on | Feb 10 20:22:19 Mapping speed, Million of reads per hour | 2821.24 Number of input reads | 4702072 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 4490965 Uniquely mapped reads % | 95.51% Average mapped length | 66.97 Number of splices: Total | 874562 Number of splices: Annotated (sjdb) | 859961 Number of splices: GT/AG | 861926 Number of splices: GC/AG | 10722 Number of splices: AT/AC | 933 Number of splices: Non-canonical | 981 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 145898 % of reads mapped to multiple loci | 3.10% Number of reads mapped to too many loci | 52332 % of reads mapped to too many loci | 1.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.25% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 65209 65209 65209 N_multimapping 145898 145898 145898 N_noFeature 202386 2318930 2344960 N_ambiguous 42811 6577 6831 UnstrandedReadsAssigned:4245768 PositiveStrandReadsAssigned:2165458 NegativeStrandReadsAssigned:2139174 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207767 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207767-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,702,072 reads, 4,377,846 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,014 rounds 52401 SRR3207767.ke.tsv 34699 SRR3207767.se.tsv 87100 total ==> SRR3207767.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 124 22.1113 Potri.005G024800.1.v4.1 1035 936 14 5.11822 Potri.004G059700.1.v4.1 961 862 3 1.19092 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 74.56 8.97104 Potri.016G087400.1.v4.1 270 171 140 280.155 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 19 3.88387 Potri.012G127500.1.v4.1 977 878 580 226.048 ==> SRR3207767.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 500 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 76 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207767 completed mapping pipeline successfully