Starting /dee2/code/volunteer_pipeline.sh SRR3207768 current disk space = 3056074211328 free memory = 1409275808 SRR3207768 SRAfilesize 6ebe9aa8a2a0b37a79451147614e2e72 SRR3207768.sra SRR3207768.sra file validated SRR3207768 is single end SRR3207768 is conventional basespace SRR3207768 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207768_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.55825 40.0 38.0 40.0 35.0 40.0 2 38.27125 40.0 38.0 40.0 35.0 40.0 3 38.399 40.0 38.0 40.0 35.0 40.0 4 38.319 40.0 38.0 40.0 35.0 40.0 5 38.32725 40.0 38.0 40.0 35.0 40.0 6 38.3375 40.0 38.0 40.0 35.0 40.0 7 38.2855 40.0 38.0 40.0 35.0 40.0 8 38.24875 40.0 38.0 40.0 35.0 40.0 9 38.18175 40.0 38.0 40.0 35.0 40.0 10 38.1955 39.0 38.0 40.0 35.0 40.0 11 38.17575 39.0 38.0 40.0 35.0 40.0 12 38.128 39.0 38.0 40.0 35.0 40.0 13 38.1105 39.0 38.0 40.0 35.0 40.0 14 38.01325 39.0 38.0 40.0 35.0 40.0 15 37.9875 39.0 38.0 40.0 34.0 40.0 16 38.00575 39.0 38.0 40.0 35.0 40.0 17 37.946 39.0 38.0 40.0 34.0 40.0 18 37.8115 39.0 38.0 40.0 33.0 40.0 19 37.84775 39.0 38.0 40.0 33.0 40.0 20 37.8035 39.0 38.0 40.0 33.0 40.0 21 37.737 39.0 38.0 40.0 33.0 40.0 22 37.649 39.0 38.0 40.0 33.0 40.0 23 37.5715 39.0 38.0 40.0 33.0 40.0 24 37.5435 39.0 38.0 40.0 33.0 40.0 25 37.50375 39.0 38.0 40.0 33.0 40.0 26 37.41575 39.0 38.0 40.0 33.0 40.0 27 37.24375 39.0 37.0 40.0 33.0 40.0 28 37.2425 39.0 37.0 40.0 33.0 40.0 29 37.15525 39.0 37.0 40.0 33.0 40.0 30 36.932 39.0 36.0 40.0 32.0 40.0 31 36.79625 39.0 36.0 40.0 32.0 40.0 32 36.61525 39.0 36.0 40.0 31.0 40.0 33 36.709 39.0 36.0 40.0 31.0 40.0 34 36.63975 39.0 36.0 40.0 31.0 40.0 35 36.59125 39.0 36.0 40.0 31.0 40.0 36 36.55425 39.0 36.0 40.0 31.0 40.0 37 36.48425 39.0 36.0 40.0 31.0 40.0 38 36.3905 39.0 36.0 40.0 31.0 40.0 39 36.22425 39.0 36.0 40.0 30.0 40.0 40 36.0875 39.0 35.0 40.0 30.0 40.0 41 36.0715 39.0 36.0 40.0 31.0 40.0 42 35.92975 39.0 35.0 40.0 30.0 40.0 43 35.73375 38.0 35.0 39.0 30.0 40.0 44 35.73025 38.0 35.0 39.0 30.0 40.0 45 35.6005 38.0 35.0 39.0 30.0 40.0 46 35.70575 38.0 35.0 39.0 30.0 40.0 47 35.52275 38.0 35.0 39.0 30.0 40.0 48 35.33125 38.0 35.0 39.0 30.0 40.0 49 35.26175 38.0 35.0 39.0 30.0 40.0 50 35.061 38.0 35.0 39.0 29.0 40.0 51 34.9115 38.0 35.0 39.0 29.0 40.0 52 34.73325 38.0 34.0 39.0 29.0 40.0 53 34.54075 37.0 34.0 39.0 29.0 40.0 54 34.23175 37.0 33.0 39.0 27.0 40.0 55 34.1985 37.0 33.0 39.0 28.0 39.0 56 33.93325 37.0 33.0 39.0 27.0 39.0 57 33.72075 36.0 33.0 39.0 27.0 39.0 58 33.45425 36.0 33.0 39.0 26.0 39.0 59 33.30975 36.0 33.0 38.0 25.0 39.0 60 32.95475 36.0 33.0 38.0 24.0 39.0 61 32.7405 36.0 33.0 38.0 23.0 39.0 62 32.623 36.0 33.0 38.0 23.0 39.0 63 32.36775 36.0 33.0 38.0 23.0 39.0 64 32.05825 36.0 32.0 38.0 21.0 39.0 65 31.8575 35.0 32.0 38.0 20.0 39.0 66 31.50525 35.0 32.0 38.0 15.0 39.0 67 31.30125 35.0 31.0 37.0 8.0 39.0 68 30.76025 34.0 31.0 37.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 1.0 5 1.0 6 2.0 7 2.0 8 5.0 9 2.0 10 7.0 11 3.0 12 10.0 13 12.0 14 8.0 15 9.0 16 13.0 17 14.0 18 12.0 19 6.0 20 13.0 21 23.0 22 17.0 23 12.0 24 19.0 25 30.0 26 26.0 27 37.0 28 37.0 29 42.0 30 56.0 31 68.0 32 92.0 33 108.0 34 146.0 35 241.0 36 326.0 37 642.0 38 1109.0 39 846.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.250000000000004 15.075 14.274999999999999 43.4 2 20.80823293172691 21.460843373493976 36.997991967871485 20.73293172690763 3 23.525 25.6 26.674999999999997 24.2 4 24.224999999999998 31.374999999999996 21.625 22.775000000000002 5 25.45 34.825 22.325 17.4 6 18.925 37.25 24.025 19.8 7 16.579144786196547 17.5293823455864 44.086021505376344 21.80545136284071 8 19.075 23.375 29.95 27.6 9 19.45 22.875 32.75 24.925 10 18.45 39.550000000000004 24.85 17.150000000000002 11 24.925 28.025 22.675 24.375 12 21.099999999999998 24.8 28.95 25.15 13 19.75 27.975 31.65 20.625 14 20.925 27.825 30.175 21.075 15 21.575 26.525 29.275000000000002 22.625 16 21.6 27.950000000000003 27.975 22.475 17 22.525000000000002 27.425 28.499999999999996 21.55 18 21.325 28.025 27.400000000000002 23.25 19 21.125 27.275 28.4 23.200000000000003 20 22.675 27.275 29.049999999999997 21.0 21 22.225 28.299999999999997 27.275 22.2 22 20.974999999999998 28.325 28.775000000000002 21.925 23 22.175 28.749999999999996 27.05 22.025 24 20.9 29.25 27.025 22.825 25 20.575 28.375 27.85 23.200000000000003 26 21.625 28.425 28.249999999999996 21.7 27 20.7551887971993 28.08202050512628 27.7569392348087 23.40585146286572 28 20.930232558139537 28.257064266066518 28.882220555138783 21.930482620655166 29 22.125 27.250000000000004 28.1 22.525000000000002 30 22.18054513628407 28.432108027006752 26.9567391847962 22.43060765191298 31 21.7 28.749999999999996 26.8 22.75 32 21.475 28.775000000000002 27.650000000000002 22.1 33 21.05 28.125 28.349999999999998 22.475 34 22.225 27.575 27.3 22.900000000000002 35 21.375 28.7 28.199999999999996 21.725 36 21.525 28.425 27.175 22.875 37 21.025 27.6 28.000000000000004 23.375 38 20.849999999999998 29.075 27.925 22.15 39 21.05 28.075 28.275 22.6 40 21.125 28.65 28.625 21.6 41 21.175 28.975 28.525 21.325 42 23.1 27.900000000000002 28.199999999999996 20.8 43 20.599999999999998 28.175 27.825 23.400000000000002 44 21.9 27.775 27.975 22.35 45 21.4 28.475 27.85 22.275 46 22.375 26.875 28.15 22.6 47 21.95 29.299999999999997 27.400000000000002 21.349999999999998 48 21.05 27.950000000000003 27.825 23.175 49 20.974999999999998 27.400000000000002 27.775 23.849999999999998 50 21.725 28.575 27.650000000000002 22.05 51 21.175 29.125 27.650000000000002 22.05 52 23.0 27.6 28.125 21.275 53 23.175 28.475 26.5 21.85 54 21.224999999999998 27.625 28.725 22.425 55 20.5 29.225 27.400000000000002 22.875 56 21.224999999999998 28.7 27.775 22.3 57 21.349999999999998 27.825 28.125 22.7 58 22.05 27.450000000000003 27.900000000000002 22.6 59 22.025 28.975 26.6 22.400000000000002 60 21.349999999999998 29.775000000000002 26.75 22.125 61 22.275 28.349999999999998 27.375 22.0 62 23.25 27.025 28.525 21.2 63 22.2 28.299999999999997 28.125 21.375 64 22.125 27.700000000000003 28.825 21.349999999999998 65 23.05 28.525 26.450000000000003 21.975 66 21.775 28.125 27.900000000000002 22.2 67 22.05 27.55 28.225 22.175 68 23.225 26.875 27.825 22.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 2.0 17 1.0 18 0.5 19 1.0 20 1.0 21 3.5 22 6.0 23 4.5 24 4.5 25 6.0 26 7.5 27 20.0 28 31.0 29 27.5 30 35.5 31 47.0 32 56.5 33 75.5 34 85.0 35 113.0 36 157.5 37 174.0 38 200.5 39 254.0 40 308.0 41 335.0 42 360.0 43 365.5 44 346.0 45 359.0 46 345.0 47 318.0 48 299.5 49 256.5 50 232.0 51 203.0 52 162.5 53 151.0 54 125.5 55 82.5 56 65.0 57 53.0 58 33.5 59 26.0 60 25.0 61 18.0 62 12.0 63 11.5 64 10.0 65 6.5 66 4.0 67 3.5 68 2.5 69 2.0 70 1.5 71 1.5 72 2.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.025 28 0.025 29 0.0 30 0.025 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410512 spots for SRR3207768.sra Written 410512 spots for SRR3207768.sra Read 410522 spots for SRR3207768.sra Written 410522 spots for SRR3207768.sra SRR ids: ['SRR3207768.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oya3ctz1 SRR3207768.sra spots: 8210250 blocks: [[1, 410512], [410513, 821024], [821025, 1231536], [1231537, 1642048], [1642049, 2052560], [2052561, 2463072], [2463073, 2873584], [2873585, 3284096], [3284097, 3694608], [3694609, 4105120], [4105121, 4515632], [4515633, 4926144], [4926145, 5336656], [5336657, 5747168], [5747169, 6157680], [6157681, 6568192], [6568193, 6978704], [6978705, 7389216], [7389217, 7799728], [7799729, 8210250]] SRR3207768 file size 1732195 SRR3207768 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207768 SRR3207768_1.fastq Input file: SRR3207768_1.fastq trimmed: SRR3207768-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:30:46 2025 >> started Mon Feb 10 20:30:53 2025 >> done (7.233s) 8210250 reads processed; of these: 14764 ( 0.18%) short reads filtered out after trimming by size control 17309 ( 0.21%) empty reads filtered out after trimming by size control 8178177 (99.61%) reads available; of these: 527290 ( 6.45%) trimmed reads available after processing 7650887 (93.55%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1290 0.02% 19 2225 0.03% 20 3804 0.05% 21 1203 0.01% 22 1477 0.02% 23 2463 0.03% 24 4139 0.05% 25 7651 0.09% 26 1822 0.02% 27 2297 0.03% 28 3230 0.04% 29 5207 0.06% 30 9209 0.11% 31 2313 0.03% 32 2797 0.03% 33 3528 0.04% 34 5579 0.07% 35 9516 0.12% 36 2409 0.03% 37 3049 0.04% 38 4373 0.05% 39 7549 0.09% 40 12985 0.16% 41 3483 0.04% 42 3316 0.04% 43 4853 0.06% 44 8231 0.10% 45 14599 0.18% 46 3473 0.04% 47 4705 0.06% 48 7042 0.09% 49 12667 0.15% 50 23152 0.28% 51 4820 0.06% 52 6363 0.08% 53 9984 0.12% 54 17191 0.21% 55 33249 0.41% 56 6515 0.08% 57 8656 0.11% 58 13195 0.16% 59 24235 0.30% 60 50943 0.62% 61 8431 0.10% 62 11315 0.14% 63 17089 0.21% 64 31240 0.38% 65 58060 0.71% 66 10391 0.13% 67 29977 0.37% 68 7650887 93.55% 8178177 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=36 prefix-density=0.04 prefix-fanout=2.0 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=15 fanout-score=185.42 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=20.3 sequence=TTCTTCTTCTTC Started job on | Feb 10 20:31:12 Started mapping on | Feb 10 20:31:12 Finished on | Feb 10 20:31:22 Mapping speed, Million of reads per hour | 2944.14 Number of input reads | 8178177 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 7808876 Uniquely mapped reads % | 95.48% Average mapped length | 66.98 Number of splices: Total | 1524540 Number of splices: Annotated (sjdb) | 1497845 Number of splices: GT/AG | 1502747 Number of splices: GC/AG | 18435 Number of splices: AT/AC | 1583 Number of splices: Non-canonical | 1775 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.79 Insertion rate per base | 0.01% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244157 % of reads mapped to multiple loci | 2.99% Number of reads mapped to too many loci | 105010 % of reads mapped to too many loci | 1.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.23% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 125144 125144 125144 N_multimapping 244157 244157 244157 N_noFeature 334045 4020499 4069700 N_ambiguous 77826 12267 12919 UnstrandedReadsAssigned:7397005 PositiveStrandReadsAssigned:3776110 NegativeStrandReadsAssigned:3726257 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207768 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207768-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,178,177 reads, 7,636,024 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR3207768.ke.tsv 34699 SRR3207768.se.tsv 87100 total ==> SRR3207768.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 178.415 18.6229 Potri.005G024800.1.v4.1 1035 936 15 3.21002 Potri.004G059700.1.v4.1 961 862 5 1.16186 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 112.807 7.94508 Potri.016G087400.1.v4.1 270 171 245 286.987 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 38 4.54695 Potri.012G127500.1.v4.1 977 878 629 143.499 ==> SRR3207768.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1235 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 172 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR3207768 completed mapping pipeline successfully