Starting /dee2/code/volunteer_pipeline.sh SRR3207769 current disk space = 3056936189952 free memory = 1498341424 SRR3207769 SRAfilesize 256283e8eb950e2785edfdb1066abb4a SRR3207769.sra SRR3207769.sra file validated SRR3207769 is single end SRR3207769 is conventional basespace SRR3207769 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207769_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.26025 39.0 38.0 40.0 35.0 40.0 2 37.636 39.0 38.0 40.0 33.0 40.0 3 38.04825 39.0 38.0 40.0 33.0 40.0 4 37.97175 39.0 38.0 40.0 33.0 40.0 5 38.00575 39.0 38.0 40.0 34.0 40.0 6 38.0915 39.0 38.0 40.0 35.0 40.0 7 38.02475 39.0 38.0 40.0 35.0 40.0 8 37.9245 39.0 38.0 40.0 33.0 40.0 9 37.93 39.0 38.0 40.0 33.0 40.0 10 37.81975 39.0 38.0 40.0 33.0 40.0 11 37.84025 39.0 38.0 40.0 34.0 40.0 12 37.80525 39.0 38.0 40.0 33.0 40.0 13 37.72325 39.0 38.0 40.0 33.0 40.0 14 37.718 39.0 38.0 40.0 33.0 40.0 15 37.6375 39.0 38.0 40.0 33.0 40.0 16 37.64725 39.0 38.0 40.0 33.0 40.0 17 37.61925 39.0 38.0 40.0 33.0 40.0 18 37.4685 39.0 38.0 40.0 33.0 40.0 19 37.36025 39.0 37.0 40.0 33.0 40.0 20 37.43275 39.0 37.0 40.0 33.0 40.0 21 37.37375 39.0 37.0 40.0 33.0 40.0 22 37.29725 39.0 37.0 40.0 33.0 40.0 23 37.15175 39.0 36.0 40.0 32.0 40.0 24 37.133 39.0 36.0 40.0 33.0 40.0 25 37.08825 39.0 36.0 40.0 32.0 40.0 26 36.981 39.0 36.0 40.0 32.0 40.0 27 36.77625 39.0 36.0 40.0 31.0 40.0 28 36.69575 39.0 36.0 40.0 31.0 40.0 29 36.6115 39.0 36.0 40.0 31.0 40.0 30 36.52025 39.0 35.0 40.0 31.0 40.0 31 36.38075 39.0 36.0 40.0 30.0 40.0 32 36.133 38.0 35.0 40.0 30.0 40.0 33 36.18225 39.0 35.0 40.0 30.0 40.0 34 35.95675 38.0 35.0 40.0 29.0 40.0 35 35.90075 38.0 35.0 40.0 29.0 40.0 36 35.9885 39.0 35.0 40.0 30.0 40.0 37 35.87325 38.0 35.0 40.0 29.0 40.0 38 35.63525 38.0 35.0 40.0 29.0 40.0 39 35.6085 38.0 35.0 40.0 29.0 40.0 40 35.4265 38.0 35.0 40.0 29.0 40.0 41 35.33625 38.0 35.0 39.0 29.0 40.0 42 35.19725 38.0 35.0 39.0 28.0 40.0 43 34.9025 38.0 34.0 39.0 28.0 40.0 44 34.8065 38.0 34.0 39.0 27.0 40.0 45 34.799 38.0 34.0 39.0 28.0 40.0 46 34.8055 38.0 34.0 39.0 29.0 40.0 47 34.639 38.0 34.0 39.0 28.0 40.0 48 34.463 37.0 34.0 39.0 28.0 40.0 49 34.28325 37.0 33.0 39.0 28.0 40.0 50 33.89525 36.0 33.0 39.0 26.0 40.0 51 33.75725 37.0 33.0 39.0 26.0 40.0 52 33.5505 36.0 33.0 39.0 25.0 39.0 53 33.394 36.0 33.0 39.0 25.0 39.0 54 33.19225 36.0 33.0 38.0 25.0 39.0 55 33.01325 36.0 33.0 38.0 24.0 39.0 56 32.75125 36.0 33.0 38.0 23.0 39.0 57 32.35025 36.0 33.0 38.0 19.0 39.0 58 32.1255 36.0 32.0 38.0 20.0 39.0 59 31.9625 36.0 32.0 38.0 20.0 39.0 60 31.64975 35.0 32.0 38.0 16.0 39.0 61 31.44475 35.0 32.0 38.0 2.0 39.0 62 31.1995 35.0 31.0 38.0 2.0 39.0 63 30.852 35.0 31.0 37.0 2.0 39.0 64 30.72725 35.0 31.0 37.0 2.0 39.0 65 30.33 35.0 31.0 36.0 2.0 38.0 66 29.74475 34.0 30.0 36.0 2.0 38.0 67 29.50525 34.0 30.0 36.0 2.0 38.0 68 28.95425 33.0 29.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 1.0 7 2.0 8 5.0 9 2.0 10 8.0 11 9.0 12 8.0 13 10.0 14 9.0 15 13.0 16 26.0 17 17.0 18 13.0 19 14.0 20 26.0 21 19.0 22 22.0 23 36.0 24 31.0 25 35.0 26 34.0 27 45.0 28 52.0 29 50.0 30 67.0 31 72.0 32 104.0 33 162.0 34 167.0 35 254.0 36 440.0 37 678.0 38 1024.0 39 543.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.225 15.675 13.05 42.05 2 18.734177215189874 26.0 37.44303797468355 17.82278481012658 3 22.225 28.050000000000004 26.674999999999997 23.05 4 24.3 34.65 20.724999999999998 20.325 5 24.474999999999998 35.775 22.875 16.875 6 18.099999999999998 37.925 25.624999999999996 18.35 7 16.22905726431608 17.30432608152038 44.96124031007752 21.50537634408602 8 20.200000000000003 21.875 29.775000000000002 28.15 9 21.725 22.2 31.8 24.275 10 19.025 39.75 23.325000000000003 17.9 11 25.025 27.55 21.05 26.375 12 20.625 24.675 30.175 24.525 13 18.725 27.725 32.625 20.925 14 22.375 26.05 29.925 21.65 15 21.025 28.625 27.750000000000004 22.6 16 21.575 28.325 28.525 21.575 17 22.35 28.849999999999998 27.55 21.25 18 22.025 28.1 28.325 21.55 19 21.65 27.950000000000003 27.425 22.975 20 20.674999999999997 29.299999999999997 27.925 22.1 21 23.05 27.925 26.924999999999997 22.1 22 21.275 28.050000000000004 28.199999999999996 22.475 23 21.65 27.875 27.575 22.900000000000002 24 21.3 29.4 27.650000000000002 21.65 25 21.575 28.075 27.725 22.625 26 21.775 29.65 28.65 19.925 27 21.725 28.525 27.700000000000003 22.05 28 21.099999999999998 28.199999999999996 29.349999999999998 21.349999999999998 29 21.775 28.775000000000002 26.900000000000002 22.55 30 21.65 27.474999999999998 28.199999999999996 22.675 31 20.674999999999997 28.849999999999998 28.799999999999997 21.675 32 21.725 29.549999999999997 27.275 21.45 33 22.125 27.900000000000002 27.425 22.55 34 22.125 29.049999999999997 27.200000000000003 21.625 35 22.475 29.5 27.250000000000004 20.775 36 22.8 27.675 27.650000000000002 21.875 37 22.475 29.625 27.6 20.3 38 21.7 29.349999999999998 27.575 21.375 39 22.55 28.625 27.375 21.45 40 23.150000000000002 26.950000000000003 28.375 21.525 41 22.1 28.275 28.599999999999998 21.025 42 22.400000000000002 27.1 28.999999999999996 21.5 43 21.775 28.375 27.375 22.475 44 21.375 28.625 28.125 21.875 45 22.175 28.199999999999996 27.500000000000004 22.125 46 21.9 26.875 28.125 23.1 47 20.45 28.875 28.799999999999997 21.875 48 21.625 27.700000000000003 28.499999999999996 22.175 49 21.224999999999998 27.800000000000004 28.449999999999996 22.525000000000002 50 21.525 28.549999999999997 28.225 21.7 51 21.875 29.25 28.325 20.549999999999997 52 22.2 26.55 28.549999999999997 22.7 53 22.0 27.85 27.85 22.3 54 21.4 28.599999999999998 28.349999999999998 21.65 55 20.599999999999998 28.925 28.499999999999996 21.975 56 22.2 29.2 27.725 20.875 57 22.125 28.050000000000004 28.425 21.4 58 20.9 27.900000000000002 29.025000000000002 22.175 59 22.125 28.475 28.449999999999996 20.95 60 21.8 27.925 27.85 22.425 61 21.099999999999998 28.749999999999996 28.15 22.0 62 21.9 27.950000000000003 27.700000000000003 22.45 63 21.6 27.750000000000004 28.625 22.025 64 21.175 26.674999999999997 29.275000000000002 22.875 65 21.475 28.175 28.525 21.825 66 21.475 28.199999999999996 28.675 21.65 67 20.875 29.025000000000002 26.875 23.225 68 21.9 28.849999999999998 27.525 21.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.5 18 0.5 19 0.0 20 0.5 21 3.0 22 5.0 23 6.5 24 11.0 25 14.0 26 17.0 27 24.0 28 28.0 29 34.0 30 49.5 31 59.0 32 66.0 33 92.5 34 112.0 35 130.5 36 172.5 37 196.0 38 228.0 39 280.5 40 302.0 41 303.0 42 311.0 43 324.5 44 330.0 45 345.0 46 334.5 47 309.0 48 295.0 49 241.5 50 202.0 51 189.5 52 156.0 53 135.0 54 119.5 55 86.5 56 69.0 57 55.0 58 36.0 59 31.0 60 27.0 61 20.0 62 17.0 63 12.0 64 7.5 65 4.5 66 1.0 67 3.0 68 3.5 69 2.0 70 2.0 71 1.0 72 0.0 73 1.0 74 1.0 75 0.0 76 1.0 77 1.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463797 spots for SRR3207769.sra Written 463797 spots for SRR3207769.sra Read 463813 spots for SRR3207769.sra Written 463813 spots for SRR3207769.sra SRR ids: ['SRR3207769.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lscs_g92 SRR3207769.sra spots: 9275956 blocks: [[1, 463797], [463798, 927594], [927595, 1391391], [1391392, 1855188], [1855189, 2318985], [2318986, 2782782], [2782783, 3246579], [3246580, 3710376], [3710377, 4174173], [4174174, 4637970], [4637971, 5101767], [5101768, 5565564], [5565565, 6029361], [6029362, 6493158], [6493159, 6956955], [6956956, 7420752], [7420753, 7884549], [7884550, 8348346], [8348347, 8812143], [8812144, 9275956]] SRR3207769 file size 1957251 SRR3207769 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207769 SRR3207769_1.fastq Input file: SRR3207769_1.fastq trimmed: SRR3207769-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:20:09 2025 >> started Mon Feb 10 21:20:14 2025 >> done (4.659s) 9275956 reads processed; of these: 22873 ( 0.25%) short reads filtered out after trimming by size control 27339 ( 0.29%) empty reads filtered out after trimming by size control 9225744 (99.46%) reads available; of these: 686567 ( 7.44%) trimmed reads available after processing 8539177 (92.56%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1850 0.02% 19 3019 0.03% 20 5255 0.06% 21 1602 0.02% 22 2174 0.02% 23 3329 0.04% 24 5329 0.06% 25 9818 0.11% 26 2381 0.03% 27 3060 0.03% 28 4488 0.05% 29 7180 0.08% 30 12390 0.13% 31 3028 0.03% 32 3936 0.04% 33 4768 0.05% 34 7414 0.08% 35 12609 0.14% 36 3091 0.03% 37 4171 0.05% 38 5936 0.06% 39 9766 0.11% 40 16896 0.18% 41 4462 0.05% 42 4539 0.05% 43 6613 0.07% 44 10895 0.12% 45 19151 0.21% 46 4719 0.05% 47 6240 0.07% 48 9744 0.11% 49 16904 0.18% 50 29799 0.32% 51 6684 0.07% 52 8668 0.09% 53 13124 0.14% 54 22531 0.24% 55 42831 0.46% 56 8596 0.09% 57 11573 0.13% 58 17626 0.19% 59 31671 0.34% 60 63190 0.68% 61 11209 0.12% 62 14924 0.16% 63 22423 0.24% 64 40207 0.44% 65 74084 0.80% 66 13507 0.15% 67 37163 0.40% 68 8539177 92.56% 9225744 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=32 prefix-density=0.05 prefix-fanout=2.0 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=16 fanout-score=172.91 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=19.9 sequence=TTCTTCTTCTTC Started job on | Feb 10 21:20:26 Started mapping on | Feb 10 21:20:26 Finished on | Feb 10 21:20:35 Mapping speed, Million of reads per hour | 3690.30 Number of input reads | 9225744 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 8753680 Uniquely mapped reads % | 94.88% Average mapped length | 66.79 Number of splices: Total | 1639005 Number of splices: Annotated (sjdb) | 1611272 Number of splices: GT/AG | 1615075 Number of splices: GC/AG | 19627 Number of splices: AT/AC | 1632 Number of splices: Non-canonical | 2671 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285870 % of reads mapped to multiple loci | 3.10% Number of reads mapped to too many loci | 141026 % of reads mapped to too many loci | 1.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 186194 186194 186194 N_multimapping 285870 285870 285870 N_noFeature 424954 4538496 4580483 N_ambiguous 86693 13300 13832 UnstrandedReadsAssigned:8242033 PositiveStrandReadsAssigned:4201884 NegativeStrandReadsAssigned:4159365 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207769 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207769-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,225,744 reads, 8,540,359 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52401 SRR3207769.ke.tsv 34699 SRR3207769.se.tsv 87100 total ==> SRR3207769.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 232 21.9231 Potri.005G024800.1.v4.1 1035 936 15 2.90605 Potri.004G059700.1.v4.1 961 862 4 0.841474 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 143.28 9.13572 Potri.016G087400.1.v4.1 270 171 260 275.718 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 29.1677 3.15962 Potri.012G127500.1.v4.1 977 878 621 128.258 ==> SRR3207769.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 827 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 148 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 27 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207769 completed mapping pipeline successfully