Starting /dee2/code/volunteer_pipeline.sh SRR3207770 current disk space = 3055991537664 free memory = 1312173852 SRR3207770 SRAfilesize 5d06ed8f5214210a294dfbb7991588f7 SRR3207770.sra SRR3207770.sra file validated SRR3207770 is single end SRR3207770 is conventional basespace SRR3207770 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207770_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.312 39.0 38.0 40.0 35.0 40.0 2 37.814 39.0 38.0 40.0 34.0 40.0 3 38.05525 39.0 38.0 40.0 34.0 40.0 4 38.0365 39.0 38.0 40.0 34.0 40.0 5 38.11475 39.0 38.0 40.0 35.0 40.0 6 38.12875 39.0 38.0 40.0 35.0 40.0 7 38.11675 39.0 38.0 40.0 35.0 40.0 8 38.03925 39.0 38.0 40.0 34.0 40.0 9 38.014 39.0 38.0 40.0 34.0 40.0 10 37.9045 39.0 38.0 40.0 33.0 40.0 11 37.86125 39.0 38.0 40.0 33.0 40.0 12 37.8585 39.0 38.0 40.0 33.0 40.0 13 37.80975 39.0 38.0 40.0 33.0 40.0 14 37.77525 39.0 38.0 40.0 33.0 40.0 15 37.6665 39.0 38.0 40.0 33.0 40.0 16 37.71225 39.0 38.0 40.0 33.0 40.0 17 37.66025 39.0 38.0 40.0 33.0 40.0 18 37.557 39.0 38.0 40.0 33.0 40.0 19 37.48025 39.0 38.0 40.0 33.0 40.0 20 37.44225 39.0 37.0 40.0 33.0 40.0 21 37.424 39.0 38.0 40.0 33.0 40.0 22 37.39475 39.0 37.0 40.0 33.0 40.0 23 37.18075 39.0 37.0 40.0 32.0 40.0 24 37.17375 39.0 37.0 40.0 33.0 40.0 25 37.06675 39.0 37.0 40.0 32.0 40.0 26 37.0465 39.0 36.0 40.0 33.0 40.0 27 36.85475 39.0 36.0 40.0 31.0 40.0 28 36.752 39.0 36.0 40.0 31.0 40.0 29 36.5835 39.0 36.0 40.0 30.0 40.0 30 36.5095 39.0 36.0 40.0 30.0 40.0 31 36.388 39.0 36.0 40.0 30.0 40.0 32 36.08325 38.0 35.0 40.0 30.0 40.0 33 36.16475 39.0 35.0 40.0 30.0 40.0 34 36.0775 39.0 35.0 40.0 30.0 40.0 35 36.022 39.0 35.0 40.0 29.0 40.0 36 36.08775 39.0 35.0 40.0 30.0 40.0 37 35.996 39.0 35.0 40.0 30.0 40.0 38 35.72075 38.0 35.0 40.0 29.0 40.0 39 35.73075 38.0 35.0 40.0 29.0 40.0 40 35.50675 38.0 35.0 40.0 29.0 40.0 41 35.52925 38.0 35.0 40.0 29.0 40.0 42 35.44825 38.0 35.0 39.0 29.0 40.0 43 35.16275 38.0 35.0 39.0 28.0 40.0 44 35.09225 38.0 35.0 39.0 29.0 40.0 45 34.9755 38.0 35.0 39.0 28.0 40.0 46 35.051 38.0 35.0 39.0 29.0 40.0 47 34.896 38.0 35.0 39.0 28.0 40.0 48 34.68875 38.0 34.0 39.0 28.0 40.0 49 34.62375 38.0 34.0 39.0 28.0 40.0 50 34.3355 37.0 33.0 39.0 27.0 40.0 51 34.333 37.0 34.0 39.0 27.0 40.0 52 34.1005 37.0 33.0 39.0 27.0 40.0 53 33.881 37.0 33.0 39.0 26.0 39.0 54 33.7495 36.0 33.0 39.0 26.0 39.0 55 33.62875 36.0 33.0 39.0 26.0 39.0 56 33.2485 36.0 33.0 38.0 24.0 39.0 57 32.96375 36.0 33.0 38.0 23.0 39.0 58 32.7075 36.0 33.0 38.0 23.0 39.0 59 32.539 36.0 33.0 38.0 23.0 39.0 60 32.24675 36.0 32.0 38.0 22.0 39.0 61 32.05225 36.0 32.0 38.0 19.0 39.0 62 31.7965 35.0 32.0 38.0 19.0 39.0 63 31.554 35.0 31.0 38.0 18.0 39.0 64 31.431 35.0 31.0 38.0 17.0 39.0 65 30.99525 35.0 31.0 37.0 2.0 39.0 66 30.51425 35.0 31.0 37.0 2.0 38.0 67 30.1695 34.0 30.0 36.0 2.0 38.0 68 29.74275 34.0 29.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 1.0 6 3.0 7 1.0 8 6.0 9 3.0 10 11.0 11 11.0 12 7.0 13 9.0 14 10.0 15 13.0 16 13.0 17 16.0 18 14.0 19 15.0 20 15.0 21 12.0 22 10.0 23 19.0 24 28.0 25 33.0 26 42.0 27 45.0 28 49.0 29 67.0 30 85.0 31 74.0 32 103.0 33 115.0 34 166.0 35 271.0 36 363.0 37 689.0 38 997.0 39 682.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.475 16.900000000000002 13.775 40.849999999999994 2 20.302648171500632 24.691046658259776 36.46910466582598 18.53720050441362 3 22.3 27.450000000000003 27.150000000000002 23.1 4 24.125 34.225 19.825 21.825 5 24.375 36.8 21.375 17.45 6 18.15 37.95 24.175 19.725 7 15.753938484621155 16.879219804951237 46.236559139784944 21.13028257064266 8 18.075 22.650000000000002 29.775000000000002 29.5 9 20.575 22.25 30.85 26.325 10 19.375 39.324999999999996 23.45 17.849999999999998 11 23.5 29.2 23.925 23.375 12 20.75 25.15 29.75 24.349999999999998 13 20.724999999999998 28.675 30.15 20.45 14 20.974999999999998 27.224999999999998 30.275000000000002 21.525 15 21.175 27.125 29.5 22.2 16 22.525000000000002 29.025000000000002 27.175 21.275 17 22.525000000000002 27.474999999999998 27.425 22.575 18 21.349999999999998 27.875 27.975 22.8 19 20.200000000000003 29.225 28.999999999999996 21.575 20 21.325 28.575 27.650000000000002 22.45 21 21.925 27.975 27.650000000000002 22.45 22 20.775 28.849999999999998 27.875 22.5 23 21.075 29.25 28.825 20.849999999999998 24 21.975 26.8 29.2 22.025 25 21.675 28.175 27.900000000000002 22.25 26 21.675 29.15 28.725 20.45 27 21.6 27.650000000000002 28.000000000000004 22.75 28 21.080270067516878 28.207051762940733 27.181795448862218 23.53088272068017 29 20.625 28.375 28.199999999999996 22.8 30 21.45536384096024 28.157039259814955 28.08202050512628 22.305576394098527 31 22.125 28.95 27.125 21.8 32 21.875 28.925 28.275 20.925 33 22.675 28.375 28.749999999999996 20.200000000000003 34 21.45 29.4 27.750000000000004 21.4 35 22.1 28.375 27.575 21.95 36 21.85 29.475 27.375 21.3 37 21.9 29.549999999999997 27.825 20.724999999999998 38 21.775 27.825 28.875 21.525 39 22.825 28.349999999999998 27.750000000000004 21.075 40 21.6 28.675 27.200000000000003 22.525000000000002 41 21.7 28.425 27.750000000000004 22.125 42 20.9 28.925 27.725 22.45 43 21.45 27.150000000000002 28.725 22.675 44 20.7 29.549999999999997 28.349999999999998 21.4 45 20.375 27.875 29.025000000000002 22.725 46 22.425 27.35 28.000000000000004 22.225 47 21.925 28.7 27.125 22.25 48 21.425 27.925 28.375 22.275 49 21.05 28.875 27.925 22.15 50 21.349999999999998 28.999999999999996 28.1 21.55 51 22.1 27.825 28.325 21.75 52 23.05 27.650000000000002 28.349999999999998 20.95 53 21.6 29.075 27.675 21.65 54 20.45 29.549999999999997 29.125 20.875 55 22.2 27.950000000000003 27.025 22.825 56 22.325 28.825 28.599999999999998 20.25 57 21.175 27.900000000000002 27.175 23.75 58 20.25 29.599999999999998 28.675 21.475 59 22.325 27.425 28.175 22.075 60 21.025 27.725 27.750000000000004 23.5 61 21.925 27.800000000000004 27.325 22.95 62 21.3 29.025000000000002 28.075 21.6 63 22.7 27.425 27.400000000000002 22.475 64 21.175 27.525 28.725 22.575 65 22.2 28.325 28.025 21.45 66 21.6 28.449999999999996 28.549999999999997 21.4 67 21.275 27.750000000000004 28.9 22.075 68 22.675 28.925 28.249999999999996 20.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 2.0 18 1.5 19 1.0 20 1.5 21 4.5 22 7.0 23 7.0 24 11.0 25 15.0 26 18.0 27 22.5 28 24.0 29 33.0 30 51.5 31 61.0 32 70.5 33 94.0 34 108.0 35 121.0 36 147.0 37 160.0 38 202.0 39 276.5 40 317.5 41 326.0 42 345.0 43 349.0 44 334.0 45 342.0 46 342.5 47 335.0 48 306.5 49 248.0 50 218.0 51 191.5 52 143.5 53 122.0 54 108.5 55 75.0 56 55.0 57 52.5 58 42.0 59 34.0 60 23.0 61 13.5 62 15.0 63 12.5 64 8.5 65 5.5 66 4.0 67 2.5 68 1.5 69 2.0 70 1.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 1.0 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8750000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.025 29 0.0 30 0.025 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra Read 396628 spots for SRR3207770.sra Written 396628 spots for SRR3207770.sra Read 396611 spots for SRR3207770.sra Written 396611 spots for SRR3207770.sra SRR ids: ['SRR3207770.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wwbzmtyy SRR3207770.sra spots: 7932237 blocks: [[1, 396611], [396612, 793222], [793223, 1189833], [1189834, 1586444], [1586445, 1983055], [1983056, 2379666], [2379667, 2776277], [2776278, 3172888], [3172889, 3569499], [3569500, 3966110], [3966111, 4362721], [4362722, 4759332], [4759333, 5155943], [5155944, 5552554], [5552555, 5949165], [5949166, 6345776], [6345777, 6742387], [6742388, 7138998], [7138999, 7535609], [7535610, 7932237]] SRR3207770 file size 1673567 SRR3207770 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207770 SRR3207770_1.fastq Input file: SRR3207770_1.fastq trimmed: SRR3207770-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:34:05 2025 >> started Mon Feb 10 20:34:09 2025 >> done (3.712s) 7932237 reads processed; of these: 19396 ( 0.24%) short reads filtered out after trimming by size control 14312 ( 0.18%) empty reads filtered out after trimming by size control 7898529 (99.58%) reads available; of these: 565577 ( 7.16%) trimmed reads available after processing 7332952 (92.84%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1584 0.02% 19 2507 0.03% 20 4437 0.06% 21 1380 0.02% 22 1749 0.02% 23 2754 0.03% 24 4516 0.06% 25 7982 0.10% 26 1985 0.03% 27 2589 0.03% 28 3740 0.05% 29 5645 0.07% 30 9930 0.13% 31 2617 0.03% 32 3259 0.04% 33 3886 0.05% 34 6094 0.08% 35 10316 0.13% 36 2609 0.03% 37 3503 0.04% 38 4986 0.06% 39 8201 0.10% 40 14236 0.18% 41 3827 0.05% 42 3703 0.05% 43 5572 0.07% 44 8957 0.11% 45 15848 0.20% 46 3872 0.05% 47 5152 0.07% 48 7836 0.10% 49 13757 0.17% 50 24539 0.31% 51 5297 0.07% 52 6913 0.09% 53 10726 0.14% 54 18606 0.24% 55 35193 0.45% 56 7003 0.09% 57 9470 0.12% 58 14574 0.18% 59 26251 0.33% 60 52236 0.66% 61 9396 0.12% 62 12288 0.16% 63 18502 0.23% 64 32782 0.42% 65 60977 0.77% 66 10994 0.14% 67 30801 0.39% 68 7332952 92.84% 7898529 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=15.44 fanout-score-rank=12 prefix-density=0.10 prefix-fanout=6.6 sequence=CTGGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=16 fanout-score=169.66 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=20.0 sequence=TTCTTCTTCTTC Started job on | Feb 10 20:34:24 Started mapping on | Feb 10 20:34:25 Finished on | Feb 10 20:34:32 Mapping speed, Million of reads per hour | 4062.10 Number of input reads | 7898529 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 7542795 Uniquely mapped reads % | 95.50% Average mapped length | 66.83 Number of splices: Total | 1429520 Number of splices: Annotated (sjdb) | 1405611 Number of splices: GT/AG | 1409087 Number of splices: GC/AG | 17010 Number of splices: AT/AC | 1538 Number of splices: Non-canonical | 1885 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 245560 % of reads mapped to multiple loci | 3.11% Number of reads mapped to too many loci | 81697 % of reads mapped to too many loci | 1.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.35% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 110174 110174 110174 N_multimapping 245560 245560 245560 N_noFeature 354420 3909606 3934774 N_ambiguous 76361 11524 12080 UnstrandedReadsAssigned:7112014 PositiveStrandReadsAssigned:3621665 NegativeStrandReadsAssigned:3595941 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207770 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207770-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,898,529 reads, 7,333,227 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52401 SRR3207770.ke.tsv 34699 SRR3207770.se.tsv 87100 total ==> SRR3207770.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 192 20.7785 Potri.005G024800.1.v4.1 1035 936 22 4.88129 Potri.004G059700.1.v4.1 961 862 6 1.44554 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 121.212 8.85124 Potri.016G087400.1.v4.1 270 171 243 295.119 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 25.536 3.168 Potri.012G127500.1.v4.1 977 878 451 106.677 ==> SRR3207770.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 852 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 150 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207770 completed mapping pipeline successfully