Starting /dee2/code/volunteer_pipeline.sh SRR3207771 current disk space = 3056011894784 free memory = 1231571276 SRR3207771 SRAfilesize 32f6b26d1e402f45d1546a28129d3d0d SRR3207771.sra SRR3207771.sra file validated SRR3207771 is single end SRR3207771 is conventional basespace SRR3207771 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207771_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.2745 39.0 38.0 40.0 35.0 40.0 2 37.776 39.0 38.0 40.0 34.0 40.0 3 38.042 39.0 38.0 40.0 34.0 40.0 4 38.018 39.0 38.0 40.0 34.0 40.0 5 38.0125 39.0 38.0 40.0 33.0 40.0 6 38.063 39.0 38.0 40.0 35.0 40.0 7 38.0805 39.0 38.0 40.0 35.0 40.0 8 37.9865 39.0 38.0 40.0 35.0 40.0 9 37.91725 39.0 38.0 40.0 33.0 40.0 10 37.8535 39.0 38.0 40.0 33.0 40.0 11 37.87575 39.0 38.0 40.0 33.0 40.0 12 37.74025 39.0 38.0 40.0 33.0 40.0 13 37.7215 39.0 38.0 40.0 33.0 40.0 14 37.65875 39.0 38.0 40.0 33.0 40.0 15 37.6435 39.0 38.0 40.0 33.0 40.0 16 37.66725 39.0 38.0 40.0 33.0 40.0 17 37.62225 39.0 38.0 40.0 33.0 40.0 18 37.45525 39.0 38.0 40.0 33.0 40.0 19 37.435 39.0 37.0 40.0 33.0 40.0 20 37.39575 39.0 38.0 40.0 33.0 40.0 21 37.3935 39.0 38.0 40.0 33.0 40.0 22 37.32575 39.0 37.0 40.0 33.0 40.0 23 37.26375 39.0 37.0 40.0 33.0 40.0 24 37.13275 39.0 37.0 40.0 32.0 40.0 25 37.095 39.0 37.0 40.0 32.0 40.0 26 37.08125 39.0 36.0 40.0 33.0 40.0 27 36.8815 39.0 36.0 40.0 31.0 40.0 28 36.77975 39.0 36.0 40.0 31.0 40.0 29 36.644 39.0 36.0 40.0 31.0 40.0 30 36.6075 39.0 36.0 40.0 31.0 40.0 31 36.52825 39.0 36.0 40.0 31.0 40.0 32 36.24925 39.0 35.0 40.0 30.0 40.0 33 36.3695 39.0 36.0 40.0 30.0 40.0 34 36.199 39.0 36.0 40.0 30.0 40.0 35 36.0495 39.0 35.0 40.0 29.0 40.0 36 36.06725 39.0 35.0 40.0 30.0 40.0 37 36.02475 39.0 35.0 40.0 30.0 40.0 38 35.84375 39.0 35.0 40.0 29.0 40.0 39 35.72525 39.0 35.0 40.0 29.0 40.0 40 35.611 38.0 35.0 40.0 29.0 40.0 41 35.43225 38.0 35.0 40.0 29.0 40.0 42 35.36275 38.0 35.0 40.0 29.0 40.0 43 35.1835 38.0 35.0 39.0 28.0 40.0 44 35.08725 38.0 35.0 39.0 28.0 40.0 45 34.93075 38.0 34.0 39.0 28.0 40.0 46 35.07675 38.0 35.0 39.0 29.0 40.0 47 34.8475 38.0 34.0 39.0 28.0 40.0 48 34.69025 38.0 34.0 39.0 28.0 40.0 49 34.5635 38.0 34.0 39.0 28.0 40.0 50 34.24925 37.0 34.0 39.0 27.0 40.0 51 34.1735 38.0 34.0 39.0 27.0 40.0 52 34.0605 37.0 33.0 39.0 26.0 40.0 53 33.86825 37.0 33.0 39.0 26.0 40.0 54 33.6655 36.0 33.0 39.0 25.0 39.0 55 33.60925 36.0 33.0 39.0 25.0 39.0 56 33.1845 36.0 33.0 39.0 23.0 39.0 57 32.987 36.0 33.0 38.0 23.0 39.0 58 32.67525 36.0 33.0 38.0 23.0 39.0 59 32.533 36.0 33.0 38.0 23.0 39.0 60 32.147 36.0 32.0 38.0 20.0 39.0 61 31.95675 36.0 32.0 38.0 16.0 39.0 62 31.74125 36.0 32.0 38.0 17.0 39.0 63 31.46475 35.0 31.0 38.0 14.0 39.0 64 31.221 35.0 31.0 38.0 2.0 39.0 65 30.954 35.0 31.0 37.0 2.0 39.0 66 30.563 35.0 31.0 37.0 2.0 39.0 67 30.272 34.0 31.0 36.0 2.0 38.0 68 29.862 34.0 29.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 1.0 6 4.0 7 2.0 8 3.0 9 6.0 10 8.0 11 3.0 12 13.0 13 12.0 14 14.0 15 11.0 16 20.0 17 18.0 18 11.0 19 16.0 20 21.0 21 20.0 22 23.0 23 23.0 24 22.0 25 31.0 26 26.0 27 34.0 28 51.0 29 54.0 30 59.0 31 98.0 32 107.0 33 117.0 34 175.0 35 249.0 36 387.0 37 639.0 38 1006.0 39 715.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.950000000000003 14.524999999999999 13.475000000000001 44.05 2 20.272314674735252 23.49974785678265 37.14069591527988 19.08724155320222 3 22.05 27.625 26.525 23.799999999999997 4 24.075 34.449999999999996 20.7 20.775 5 25.650000000000002 36.025 20.724999999999998 17.599999999999998 6 17.65 38.800000000000004 23.775 19.775000000000002 7 16.625 18.375 44.55 20.45 8 18.55 23.175 30.55 27.725 9 20.775 22.375 31.95 24.9 10 18.875 38.5 25.324999999999996 17.299999999999997 11 25.525 28.999999999999996 22.15 23.325000000000003 12 21.45 24.675 30.225 23.65 13 19.25 29.15 30.825000000000003 20.775 14 20.349999999999998 28.275 29.475 21.9 15 21.75 28.050000000000004 28.000000000000004 22.2 16 21.4 28.95 28.65 21.0 17 21.6 28.4 27.825 22.175 18 22.275 28.549999999999997 26.875 22.3 19 21.75 29.7 26.625 21.925 20 22.225 28.299999999999997 27.474999999999998 22.0 21 21.525 29.049999999999997 27.6 21.825 22 22.25 28.025 26.75 22.975 23 21.925 29.175 27.425 21.475 24 21.675 29.425 26.450000000000003 22.45 25 22.35 28.725 27.200000000000003 21.725 26 22.025 28.7 28.125 21.15 27 21.3 28.95 27.325 22.425 28 21.875 28.325 28.299999999999997 21.5 29 21.275 29.175 28.475 21.075 30 21.75 27.375 28.249999999999996 22.625 31 21.175 28.15 28.275 22.400000000000002 32 22.2 28.125 28.125 21.55 33 21.7 28.449999999999996 28.050000000000004 21.8 34 21.525 28.4 28.075 22.0 35 22.6 28.125 27.150000000000002 22.125 36 21.0 28.425 26.724999999999998 23.849999999999998 37 21.475 28.65 27.625 22.25 38 21.125 28.175 28.449999999999996 22.25 39 21.099999999999998 28.7 27.875 22.325 40 21.099999999999998 28.749999999999996 27.900000000000002 22.25 41 21.9 28.375 28.000000000000004 21.725 42 20.775 29.475 27.150000000000002 22.6 43 21.224999999999998 27.05 28.675 23.05 44 22.6 28.249999999999996 27.750000000000004 21.4 45 20.875 28.425 28.65 22.05 46 21.875 28.65 28.1 21.375 47 21.95 26.724999999999998 27.750000000000004 23.575 48 19.8 29.175 27.525 23.5 49 20.849999999999998 28.475 27.950000000000003 22.725 50 21.075 29.675 27.55 21.7 51 21.224999999999998 28.449999999999996 27.650000000000002 22.675 52 22.025 27.875 27.55 22.55 53 22.675 28.299999999999997 27.05 21.975 54 21.05 28.825 28.275 21.85 55 22.15 28.749999999999996 26.900000000000002 22.2 56 21.45 28.249999999999996 28.249999999999996 22.05 57 21.95 28.575 26.75 22.725 58 21.025 29.9 28.050000000000004 21.025 59 22.8 27.975 28.199999999999996 21.025 60 21.05 28.825 27.650000000000002 22.475 61 22.35 28.249999999999996 28.549999999999997 20.849999999999998 62 22.425 28.000000000000004 28.275 21.3 63 21.825 27.975 27.6 22.6 64 23.3 28.1 26.650000000000002 21.95 65 21.625 29.275000000000002 28.199999999999996 20.9 66 23.3 28.175 27.875 20.65 67 21.45 27.375 29.299999999999997 21.875 68 22.825 28.549999999999997 27.075 21.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 1.5 21 3.5 22 5.0 23 4.5 24 6.5 25 9.0 26 12.5 27 19.0 28 22.0 29 29.0 30 45.0 31 54.0 32 68.5 33 109.5 34 136.0 35 132.0 36 158.0 37 188.0 38 204.0 39 247.5 40 302.5 41 330.0 42 335.5 43 353.0 44 365.0 45 347.0 46 341.5 47 354.0 48 316.5 49 241.5 50 204.0 51 200.5 52 167.0 53 137.0 54 107.5 55 75.5 56 73.0 57 56.5 58 31.5 59 23.0 60 21.5 61 15.0 62 10.0 63 9.5 64 10.5 65 8.5 66 5.0 67 4.5 68 2.5 69 1.0 70 2.0 71 2.0 72 1.0 73 1.0 74 1.0 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.8500000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra Read 334331 spots for SRR3207771.sra Written 334331 spots for SRR3207771.sra Read 334314 spots for SRR3207771.sra Written 334314 spots for SRR3207771.sra SRR ids: ['SRR3207771.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wql1wu33 SRR3207771.sra spots: 6686297 blocks: [[1, 334314], [334315, 668628], [668629, 1002942], [1002943, 1337256], [1337257, 1671570], [1671571, 2005884], [2005885, 2340198], [2340199, 2674512], [2674513, 3008826], [3008827, 3343140], [3343141, 3677454], [3677455, 4011768], [4011769, 4346082], [4346083, 4680396], [4680397, 5014710], [5014711, 5349024], [5349025, 5683338], [5683339, 6017652], [6017653, 6351966], [6351967, 6686297]] SRR3207771 file size 1410528 SRR3207771 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207771 SRR3207771_1.fastq Input file: SRR3207771_1.fastq trimmed: SRR3207771-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:34:44 2025 >> started Mon Feb 10 20:34:48 2025 >> done (3.926s) 6686297 reads processed; of these: 15931 ( 0.24%) short reads filtered out after trimming by size control 10713 ( 0.16%) empty reads filtered out after trimming by size control 6659653 (99.60%) reads available; of these: 474369 ( 7.12%) trimmed reads available after processing 6185284 (92.88%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1327 0.02% 19 2055 0.03% 20 3643 0.05% 21 1129 0.02% 22 1413 0.02% 23 2230 0.03% 24 3890 0.06% 25 6887 0.10% 26 1657 0.02% 27 2093 0.03% 28 3063 0.05% 29 4795 0.07% 30 8244 0.12% 31 2085 0.03% 32 2578 0.04% 33 3224 0.05% 34 5094 0.08% 35 8686 0.13% 36 2225 0.03% 37 2863 0.04% 38 4006 0.06% 39 6583 0.10% 40 11602 0.17% 41 3191 0.05% 42 3204 0.05% 43 4552 0.07% 44 7593 0.11% 45 13170 0.20% 46 3294 0.05% 47 4286 0.06% 48 6512 0.10% 49 11561 0.17% 50 20916 0.31% 51 4514 0.07% 52 5937 0.09% 53 9213 0.14% 54 15848 0.24% 55 29270 0.44% 56 5924 0.09% 57 7955 0.12% 58 12384 0.19% 59 22053 0.33% 60 43809 0.66% 61 7837 0.12% 62 10478 0.16% 63 15380 0.23% 64 27679 0.42% 65 51582 0.77% 66 9258 0.14% 67 25597 0.38% 68 6185284 92.88% 6659653 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=17.53 fanout-score-rank=10 prefix-density=0.10 prefix-fanout=7.0 sequence=CTGGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=13 fanout-score=187.22 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=20.8 sequence=TTCTTCTTCTTC Started job on | Feb 10 20:35:06 Started mapping on | Feb 10 20:35:07 Finished on | Feb 10 20:35:13 Mapping speed, Million of reads per hour | 3995.79 Number of input reads | 6659653 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 6336522 Uniquely mapped reads % | 95.15% Average mapped length | 66.86 Number of splices: Total | 1215663 Number of splices: Annotated (sjdb) | 1194508 Number of splices: GT/AG | 1198215 Number of splices: GC/AG | 14611 Number of splices: AT/AC | 1336 Number of splices: Non-canonical | 1501 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.01% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 203816 % of reads mapped to multiple loci | 3.06% Number of reads mapped to too many loci | 101133 % of reads mapped to too many loci | 1.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.26% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 119315 119315 119315 N_multimapping 203816 203816 203816 N_noFeature 300903 3272982 3321755 N_ambiguous 62552 9763 10169 UnstrandedReadsAssigned:5973067 PositiveStrandReadsAssigned:3053777 NegativeStrandReadsAssigned:3004598 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207771 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207771-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,659,653 reads, 6,177,301 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR3207771.ke.tsv 34699 SRR3207771.se.tsv 87100 total ==> SRR3207771.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 211 26.8776 Potri.005G024800.1.v4.1 1035 936 25 6.529 Potri.004G059700.1.v4.1 961 862 4 1.13432 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 100.929 8.67495 Potri.016G087400.1.v4.1 270 171 224 320.21 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 35 5.11087 Potri.012G127500.1.v4.1 977 878 523 145.609 ==> SRR3207771.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 680 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 134 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207771 completed mapping pipeline successfully