Starting /dee2/code/volunteer_pipeline.sh SRR3207772 current disk space = 3057011527680 free memory = 1574000068 SRR3207772 SRAfilesize d3f4325b8ae46643b049c72959a327ca SRR3207772.sra SRR3207772.sra file validated SRR3207772 is single end SRR3207772 is conventional basespace SRR3207772 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207772_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.54875 34.0 31.0 34.0 30.0 34.0 2 31.906 34.0 31.0 34.0 30.0 34.0 3 32.8535 34.0 33.0 34.0 30.0 34.0 4 36.47325 37.0 37.0 37.0 35.0 37.0 5 36.42175 37.0 37.0 37.0 35.0 37.0 6 36.1965 37.0 37.0 37.0 35.0 37.0 7 36.4185 37.0 37.0 37.0 35.0 37.0 8 36.33075 37.0 37.0 37.0 35.0 37.0 9 38.33975 39.0 39.0 39.0 37.0 39.0 10-11 38.376625 39.0 39.0 39.0 37.0 39.0 12-13 38.272375 39.0 39.0 39.0 37.0 39.0 14-15 39.885125 41.0 40.0 41.0 38.0 41.0 16-17 39.984750000000005 41.0 40.0 41.0 38.0 41.0 18-19 39.9005 41.0 40.0 41.0 38.0 41.0 20-21 39.69775 41.0 40.0 41.0 37.0 41.0 22-23 39.526624999999996 41.0 40.0 41.0 37.0 41.0 24-25 39.279375 41.0 39.0 41.0 36.5 41.0 26-27 38.651250000000005 40.0 38.5 41.0 34.5 41.0 28-29 38.635000000000005 40.0 38.5 41.0 34.5 41.0 30-31 38.5445 40.0 38.0 41.0 34.5 41.0 32-33 38.612 40.0 38.0 41.0 34.5 41.0 34-35 38.485625 40.0 38.0 41.0 34.5 41.0 36-37 38.385 40.0 38.5 41.0 34.0 41.0 38-39 38.921125 41.0 39.0 41.0 35.5 41.0 40-41 38.914625 41.0 39.0 41.0 35.5 41.0 42-43 38.735 41.0 39.0 41.0 35.0 41.0 44-45 38.697 41.0 39.0 41.0 35.0 41.0 46-47 38.288875 40.5 38.5 41.0 34.0 41.0 48-49 38.203374999999994 40.0 38.0 41.0 33.5 41.0 50-51 38.0635 40.0 38.5 41.0 33.5 41.0 52-53 38.0455 40.0 38.0 41.0 33.0 41.0 54-55 37.94825 40.0 38.0 41.0 33.0 41.0 56-57 37.649625 40.0 37.5 41.0 33.0 41.0 58-59 36.881875 40.0 37.0 41.0 31.0 41.0 60-61 36.75925 40.0 36.0 41.0 31.0 41.0 62-63 36.579125000000005 39.0 36.0 41.0 31.0 41.0 64-65 36.087 39.0 35.0 41.0 29.5 41.0 66-67 35.88475 38.5 35.0 40.5 30.0 41.0 68-69 34.81 37.0 34.0 40.0 27.0 41.0 70-71 34.59925 37.0 34.0 39.0 28.0 41.0 72-73 34.235125 36.5 34.0 39.0 27.0 40.5 74-75 33.770125 36.0 34.0 38.5 27.0 39.5 76-77 32.604625 35.0 32.5 37.0 26.0 39.0 78-79 33.09625 35.0 34.0 37.0 27.0 39.0 80-81 32.7365 35.0 34.0 36.5 26.5 37.5 82-83 32.28175 35.0 33.5 36.0 26.0 37.0 84-85 31.94925 35.0 33.0 36.0 25.0 37.0 86-87 31.366125 35.0 32.5 35.0 22.5 36.0 88-89 30.446375 35.0 31.5 35.0 14.0 36.0 90-91 30.116374999999998 35.0 31.5 35.0 6.5 36.0 92-93 29.307625 34.0 30.0 35.0 2.0 35.0 94-95 28.985625 34.0 29.5 35.0 2.0 35.0 96-97 29.010625 34.0 29.5 35.0 2.0 35.0 98-99 29.108625 34.0 31.0 35.0 2.0 35.0 100 28.77675 34.0 31.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 5.0 9 7.0 10 5.0 11 5.0 12 4.0 13 8.0 14 13.0 15 8.0 16 8.0 17 10.0 18 18.0 19 19.0 20 16.0 21 11.0 22 19.0 23 23.0 24 24.0 25 27.0 26 36.0 27 41.0 28 32.0 29 45.0 30 67.0 31 85.0 32 73.0 33 94.0 34 151.0 35 194.0 36 389.0 37 856.0 38 1425.0 39 279.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.9912782774598 15.344780594167348 17.606977378032163 39.05696375034069 2 19.925 23.9 37.425000000000004 18.75 3 22.575 27.35 27.525 22.55 4 24.05 33.525 20.150000000000002 22.275 5 23.275000000000002 36.0 23.275000000000002 17.45 6 19.3 36.75 24.05 19.900000000000002 7 15.950000000000001 18.4 44.55 21.099999999999998 8 19.525000000000002 23.525 29.175 27.775 9 20.724999999999998 23.400000000000002 30.325000000000003 25.55 10-11 22.325 34.125 21.8 21.75 12-13 20.65 26.137500000000003 30.362499999999997 22.85 14-15 20.65 28.9125 27.8125 22.625 16-17 21.762500000000003 29.049999999999997 27.900000000000002 21.2875 18-19 22.525000000000002 29.299999999999997 26.087500000000002 22.0875 20-21 21.512500000000003 28.3875 27.6 22.5 22-23 21.6 29.1375 27.3125 21.95 24-25 21.4 28.8625 27.6 22.1375 26-27 22.0875 28.6125 26.787499999999998 22.5125 28-29 21.625 28.725 27.762500000000003 21.8875 30-31 21.025 29.65 27.3125 22.0125 32-33 21.475 28.299999999999997 28.325 21.9 34-35 22.3125 28.787499999999998 26.887499999999996 22.0125 36-37 21.875 28.812500000000004 26.924999999999997 22.3875 38-39 22.0875 28.6625 27.6 21.65 40-41 22.0 28.975 26.825 22.2 42-43 21.5 27.987499999999997 27.900000000000002 22.6125 44-45 21.95 28.1875 27.250000000000004 22.6125 46-47 21.55 28.1875 27.875 22.3875 48-49 21.77772221527691 27.753469183647955 28.9536192024003 21.515189398674835 50-51 21.7375 28.9875 27.3875 21.8875 52-53 22.0125 28.65 27.450000000000003 21.8875 54-55 21.75 28.512500000000003 27.962500000000002 21.775 56-57 21.59289822455614 27.84446111527882 28.157039259814955 22.405601400350086 58-59 21.75 27.6875 28.1625 22.400000000000002 60-61 22.175 27.487499999999997 28.0875 22.25 62-63 21.975 27.762500000000003 28.512500000000003 21.75 64-65 22.2 28.525 27.462500000000002 21.8125 66-67 21.912499999999998 28.075 28.050000000000004 21.9625 68-69 21.8125 27.900000000000002 27.474999999999998 22.8125 70-71 22.3 28.475 27.675 21.55 72-73 21.265158144768094 28.54106763345418 28.103512939117394 22.090261282660332 74-75 21.987499999999997 27.5875 28.7375 21.6875 76-77 22.425 27.8375 27.762500000000003 21.975 78-79 22.48062015503876 28.08202050512628 27.981995498874717 21.45536384096024 80-81 22.2625 28.825 27.275 21.637500000000003 82-83 21.95 28.487499999999997 27.5625 22.0 84-85 22.50562640660165 27.981995498874717 27.70692673168292 21.80545136284071 86-87 21.9777472184023 28.60357544693087 28.56607075884486 20.852606575821977 88-89 21.45 28.199999999999996 27.775 22.575 90-91 21.2 26.9125 28.762500000000003 23.125 92-93 22.425 28.3875 27.5125 21.675 94-95 21.6625 27.950000000000003 28.7375 21.65 96-97 22.7 27.5125 27.762500000000003 22.025 98-99 21.525 27.55 28.3375 22.5875 100 22.8 27.650000000000002 27.950000000000003 21.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 4.0 26 4.5 27 5.5 28 9.0 29 14.0 30 22.0 31 28.0 32 33.5 33 40.0 34 56.5 35 75.0 36 98.5 37 120.0 38 147.5 39 178.0 40 199.5 41 219.5 42 239.5 43 266.5 44 290.5 45 291.5 46 257.5 47 237.0 48 221.5 49 189.5 50 156.0 51 121.0 52 103.0 53 85.5 54 63.5 55 42.0 56 25.5 57 30.5 58 28.5 59 16.0 60 10.5 61 10.0 62 10.5 63 6.5 64 3.0 65 3.0 66 2.5 67 3.5 68 5.0 69 4.5 70 2.5 71 1.0 72 0.5 73 0.5 74 2.0 75 2.0 76 0.5 77 1.0 78 1.0 79 0.5 80 0.5 81 0.5 82 1.0 83 1.0 84 0.5 85 1.5 86 1.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0125 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.025 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.025 80-81 0.0 82-83 0.0 84-85 0.025 86-87 0.0125 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.0875 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012192 spots for SRR3207772.sra Written 2012192 spots for SRR3207772.sra Read 2012197 spots for SRR3207772.sra Written 2012197 spots for SRR3207772.sra SRR ids: ['SRR3207772.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1ayqlyqd SRR3207772.sra spots: 40243845 blocks: [[1, 2012192], [2012193, 4024384], [4024385, 6036576], [6036577, 8048768], [8048769, 10060960], [10060961, 12073152], [12073153, 14085344], [14085345, 16097536], [16097537, 18109728], [18109729, 20121920], [20121921, 22134112], [22134113, 24146304], [24146305, 26158496], [26158497, 28170688], [28170689, 30182880], [30182881, 32195072], [32195073, 34207264], [34207265, 36219456], [36219457, 38231648], [38231649, 40243845]] SRR3207772 file size 10462334 SRR3207772 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207772 SRR3207772_1.fastq Input file: SRR3207772_1.fastq trimmed: SRR3207772-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:52:28 2025 >> started Mon Feb 10 21:52:49 2025 >> done (21.511s) 40243845 reads processed; of these: 7912 ( 0.02%) short reads filtered out after trimming by size control 18620 ( 0.05%) empty reads filtered out after trimming by size control 40217313 (99.93%) reads available; of these: 3711004 ( 9.23%) trimmed reads available after processing 36506309 (90.77%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2187 0.01% 19 2942 0.01% 20 4333 0.01% 21 5895 0.01% 22 8237 0.02% 23 12117 0.03% 24 16038 0.04% 25 21681 0.05% 26 21600 0.05% 27 20736 0.05% 28 21915 0.05% 29 22210 0.06% 30 23242 0.06% 31 23715 0.06% 32 24152 0.06% 33 23288 0.06% 34 24723 0.06% 35 25104 0.06% 36 26427 0.07% 37 25965 0.06% 38 26428 0.07% 39 27060 0.07% 40 28020 0.07% 41 28844 0.07% 42 30228 0.08% 43 30644 0.08% 44 31353 0.08% 45 31754 0.08% 46 32589 0.08% 47 32248 0.08% 48 31995 0.08% 49 32927 0.08% 50 33631 0.08% 51 33926 0.08% 52 33923 0.08% 53 33490 0.08% 54 34048 0.08% 55 34025 0.08% 56 34175 0.08% 57 34623 0.09% 58 34112 0.08% 59 34464 0.09% 60 34086 0.08% 61 34298 0.09% 62 34506 0.09% 63 34455 0.09% 64 35200 0.09% 65 35743 0.09% 66 36416 0.09% 67 37436 0.09% 68 37686 0.09% 69 37677 0.09% 70 40317 0.10% 71 39188 0.10% 72 39915 0.10% 73 40994 0.10% 74 40898 0.10% 75 42740 0.11% 76 29523 0.07% 77 33168 0.08% 78 37574 0.09% 79 40307 0.10% 80 41781 0.10% 81 44024 0.11% 82 45651 0.11% 83 48040 0.12% 84 50180 0.12% 85 51990 0.13% 86 54054 0.13% 87 56825 0.14% 88 59716 0.15% 89 65376 0.16% 90 71070 0.18% 91 79219 0.20% 92 89346 0.22% 93 100525 0.25% 94 119051 0.30% 95 142176 0.35% 96 159569 0.40% 97 203100 0.51% 98 216953 0.54% 99 209217 0.52% 100 36506309 90.77% 40217313 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=30 prefix-density=0.02 prefix-fanout=2.8 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=11 fanout-score=193.80 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=25.3 sequence=AAGAAGAAGAAA Started job on | Feb 10 21:53:08 Started mapping on | Feb 10 21:53:08 Finished on | Feb 10 21:53:47 Mapping speed, Million of reads per hour | 3712.37 Number of input reads | 40217313 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 38230528 Uniquely mapped reads % | 95.06% Average mapped length | 97.56 Number of splices: Total | 10684116 Number of splices: Annotated (sjdb) | 10487019 Number of splices: GT/AG | 10526701 Number of splices: GC/AG | 129896 Number of splices: AT/AC | 10645 Number of splices: Non-canonical | 16874 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.10 Insertion rate per base | 0.02% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 917283 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 672560 % of reads mapped to too many loci | 1.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.98% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1069502 1069502 1069502 N_multimapping 917283 917283 917283 N_noFeature 1850750 19866747 19961024 N_ambiguous 388850 67026 68815 UnstrandedReadsAssigned:35990928 PositiveStrandReadsAssigned:18296755 NegativeStrandReadsAssigned:18200689 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207772 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207772-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,217,313 reads, 37,062,284 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR3207772.ke.tsv 34699 SRR3207772.se.tsv 87100 total ==> SRR3207772.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1367.5 29.0109 Potri.005G024800.1.v4.1 1035 936 340 14.7881 Potri.004G059700.1.v4.1 961 862 17 0.80288 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 658.219 9.42215 Potri.016G087400.1.v4.1 270 171 1480.56 352.483 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 173 4.20726 Potri.012G127500.1.v4.1 977 878 3484 161.545 ==> SRR3207772.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5643 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 648 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 36 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR3207772 completed mapping pipeline successfully