Starting /dee2/code/volunteer_pipeline.sh SRR3207773 current disk space = 3056351301632 free memory = 1012364516 SRR3207773 SRAfilesize 3977f77c12829682e7f2332e76f050bb SRR3207773.sra SRR3207773.sra file validated SRR3207773 is single end SRR3207773 is conventional basespace SRR3207773 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207773_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6885 34.0 31.0 34.0 30.0 34.0 2 31.75575 34.0 31.0 34.0 30.0 34.0 3 31.72075 34.0 31.0 34.0 28.0 34.0 4 35.99225 37.0 35.0 37.0 35.0 37.0 5 35.70975 37.0 35.0 37.0 35.0 37.0 6 36.16725 37.0 35.0 37.0 35.0 37.0 7 36.145 37.0 35.0 37.0 35.0 37.0 8 36.206 37.0 36.0 37.0 35.0 37.0 9 38.05275 39.0 38.0 39.0 35.0 39.0 10-11 38.001875 39.0 38.0 39.0 35.0 39.0 12-13 37.90675 39.0 38.0 39.0 35.0 39.0 14-15 39.348375 41.0 39.0 41.0 36.0 41.0 16-17 39.369249999999994 41.0 39.0 41.0 36.0 41.0 18-19 39.23825 41.0 39.0 41.0 36.0 41.0 20-21 39.1215 40.0 39.0 41.0 35.5 41.0 22-23 38.962625 40.0 39.0 41.0 35.0 41.0 24-25 38.871125000000006 40.0 38.0 41.0 35.0 41.0 26-27 38.683875 40.0 38.0 41.0 34.5 41.0 28-29 38.410124999999994 40.0 38.0 41.0 34.0 41.0 30-31 38.127875 40.0 38.0 41.0 33.5 41.0 32-33 37.870374999999996 40.0 38.0 41.0 33.0 41.0 34-35 37.786500000000004 40.0 38.0 41.0 32.5 41.0 36-37 37.866249999999994 40.0 38.0 41.0 33.0 41.0 38-39 37.88075 40.0 38.0 41.0 32.5 41.0 40-41 38.102000000000004 40.0 38.0 41.0 33.5 41.0 42-43 37.915 40.0 38.0 41.0 33.0 41.0 44-45 37.61275 40.0 38.0 41.0 32.5 41.0 46-47 37.591875 40.0 38.0 41.0 32.5 41.0 48-49 37.0085 40.0 37.5 41.0 31.0 41.0 50-51 36.9585 40.0 37.0 41.0 30.5 41.0 52-53 36.66175 40.0 36.5 41.0 30.0 41.0 54-55 36.55825 40.0 36.5 41.0 29.5 41.0 56-57 36.195625 39.5 36.0 41.0 28.5 41.0 58-59 36.002875 39.0 36.0 41.0 28.0 41.0 60-61 35.397000000000006 39.0 35.0 40.5 27.0 41.0 62-63 35.06625 38.5 34.5 40.0 26.0 41.0 64-65 34.640625 38.0 34.0 40.0 25.0 41.0 66-67 34.38612500000001 37.5 34.0 40.0 26.0 41.0 68-69 33.94175 37.0 34.0 39.5 25.0 41.0 70-71 33.38675 36.0 33.5 39.0 23.0 41.0 72-73 32.792874999999995 36.0 33.0 39.0 20.5 40.0 74-75 31.997125 35.0 32.0 37.5 18.0 39.5 76-77 30.82325 34.5 30.5 36.5 12.0 39.0 78-79 31.086750000000002 35.0 31.0 36.5 13.0 39.0 80-81 30.719625 35.0 31.0 36.0 7.5 37.0 82-83 29.996000000000002 34.5 30.5 35.5 4.5 37.0 84-85 29.677625 34.0 30.0 35.0 2.0 36.5 86-87 29.332375 34.0 30.0 35.0 2.0 36.0 88-89 29.053 34.0 30.0 35.0 2.0 36.0 90-91 28.81475 34.0 29.0 35.0 2.0 35.5 92-93 28.50125 34.0 29.0 35.0 2.0 35.0 94-95 28.378 34.0 29.0 35.0 2.0 35.0 96-97 27.705125000000002 34.0 27.5 35.0 2.0 35.0 98-99 27.033 34.0 25.5 35.0 2.0 35.0 100 26.98775 34.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 3.0 9 5.0 10 13.0 11 11.0 12 12.0 13 9.0 14 15.0 15 17.0 16 20.0 17 18.0 18 23.0 19 18.0 20 32.0 21 31.0 22 25.0 23 34.0 24 29.0 25 39.0 26 38.0 27 43.0 28 50.0 29 74.0 30 76.0 31 101.0 32 126.0 33 149.0 34 199.0 35 266.0 36 415.0 37 852.0 38 1050.0 39 206.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.255069370330844 15.71504802561366 17.822838847385274 38.207043756670224 2 19.275000000000002 25.6 35.575 19.55 3 23.025000000000002 26.724999999999998 28.199999999999996 22.05 4 24.275 33.725 19.7 22.3 5 23.35 36.0 22.025 18.625 6 18.625 38.725 23.075000000000003 19.575 7 17.599999999999998 17.325 44.35 20.724999999999998 8 18.7 23.974999999999998 28.975 28.349999999999998 9 19.225 23.974999999999998 31.15 25.650000000000002 10-11 22.537499999999998 34.2 22.400000000000002 20.8625 12-13 20.2875 27.224999999999998 29.575000000000003 22.912499999999998 14-15 21.224999999999998 27.3625 29.65 21.762500000000003 16-17 22.4375 28.787499999999998 27.187499999999996 21.587500000000002 18-19 21.325 29.575000000000003 26.387500000000003 22.7125 20-21 21.975 26.9625 28.299999999999997 22.7625 22-23 21.912499999999998 28.812500000000004 27.0125 22.2625 24-25 22.075 29.612500000000004 26.0 22.3125 26-27 22.162499999999998 27.5625 27.650000000000002 22.625 28-29 22.2625 28.15 26.787499999999998 22.8 30-31 21.587500000000002 28.525 28.262500000000003 21.625 32-33 21.975 27.737499999999997 27.787499999999998 22.5 34-35 21.7 28.675 27.0875 22.537499999999998 36-37 21.712500000000002 27.950000000000003 28.037499999999998 22.3 38-39 21.5625 28.812500000000004 27.9125 21.712500000000002 40-41 22.275 28.3625 26.987499999999997 22.375 42-43 21.712500000000002 27.85 27.737499999999997 22.7 44-45 21.925 28.4 27.9375 21.7375 46-47 22.0 27.8125 28.249999999999996 21.9375 48-49 22.0625 27.625 27.900000000000002 22.412499999999998 50-51 22.327790973871732 28.066008251031377 27.753469183647955 21.852731591448933 52-53 22.10276284535567 28.19102387798475 27.740967620952617 21.965245655706962 54-55 22.365295661957745 27.815976997124643 28.003500437554695 21.81522690336292 56-57 21.192798199549888 28.557139284821204 28.644661165291325 21.605401350337583 58-59 22.1375 28.512500000000003 28.025 21.325 60-61 22.175 28.1875 28.249999999999996 21.3875 62-63 22.162499999999998 28.037499999999998 28.487499999999997 21.3125 64-65 22.5 28.237499999999997 27.85 21.4125 66-67 21.7875 28.475 27.3375 22.400000000000002 68-69 21.85 28.6125 27.1375 22.400000000000002 70-71 22.515314414301788 27.86598324790599 28.128516064508062 21.49018627328416 72-73 21.842960740185045 27.44436109027257 28.369592398099524 22.343085771442862 74-75 21.57769721215152 28.01600200025003 28.053506688336043 22.352794099262407 76-77 21.980222806358743 27.60045061960195 28.288897233696332 22.13042934034297 78-79 21.567891972993248 27.819454863715933 27.79444861215304 22.818204551137786 80-81 21.75543885971493 28.00700175043761 28.51962990747687 21.717929482370593 82-83 21.377672209026127 27.703462932866607 28.57857232154019 22.340292536567073 84-85 22.405601400350086 27.24431107776944 28.219554888722183 22.13053263315829 86-87 21.727715964495562 27.57844730591324 27.790973871733964 22.90286285785723 88-89 21.425 27.625 28.575 22.375 90-91 21.95 26.8375 28.9875 22.225 92-93 21.5375 27.787499999999998 28.5625 22.112499999999997 94-95 21.675 27.6875 28.525 22.112499999999997 96-97 21.5375 27.537499999999998 28.212500000000002 22.7125 98-99 21.905476369092273 28.044511127781945 27.806951737934483 22.2430607651913 100 22.20555138784696 27.35683920980245 27.206801700425103 23.23080770192548 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 3.5 26 6.5 27 8.0 28 7.0 29 11.5 30 17.0 31 22.0 32 34.0 33 40.0 34 51.0 35 65.5 36 90.5 37 107.0 38 131.0 39 176.0 40 200.5 41 229.5 42 262.5 43 279.5 44 287.5 45 279.0 46 256.5 47 249.5 48 234.0 49 178.5 50 152.5 51 136.0 52 111.0 53 100.0 54 68.0 55 38.5 56 30.0 57 25.5 58 18.5 59 20.0 60 14.0 61 6.0 62 4.0 63 3.0 64 5.0 65 6.0 66 4.5 67 3.0 68 3.0 69 3.0 70 2.5 71 1.5 72 2.0 73 2.0 74 0.5 75 1.0 76 1.0 77 0.5 78 1.0 79 0.5 80 0.5 81 0.5 82 1.0 83 1.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0125 52-53 0.0125 54-55 0.0125 56-57 0.025 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.025 74-75 0.0125 76-77 0.13749999999999998 78-79 0.025 80-81 0.025 82-83 0.0125 84-85 0.025 86-87 0.0125 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.025 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra Read 1550714 spots for SRR3207773.sra Written 1550714 spots for SRR3207773.sra Read 1550700 spots for SRR3207773.sra Written 1550700 spots for SRR3207773.sra SRR ids: ['SRR3207773.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q0dgt_k2 SRR3207773.sra spots: 31014014 blocks: [[1, 1550700], [1550701, 3101400], [3101401, 4652100], [4652101, 6202800], [6202801, 7753500], [7753501, 9304200], [9304201, 10854900], [10854901, 12405600], [12405601, 13956300], [13956301, 15507000], [15507001, 17057700], [17057701, 18608400], [18608401, 20159100], [20159101, 21709800], [21709801, 23260500], [23260501, 24811200], [24811201, 26361900], [26361901, 27912600], [27912601, 29463300], [29463301, 31014014]] SRR3207773 file size 8060181 SRR3207773 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207773 SRR3207773_1.fastq Input file: SRR3207773_1.fastq trimmed: SRR3207773-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:58:16 2025 >> started Mon Feb 10 20:58:32 2025 >> done (16.526s) 31014014 reads processed; of these: 7030 ( 0.02%) short reads filtered out after trimming by size control 45785 ( 0.15%) empty reads filtered out after trimming by size control 30961199 (99.83%) reads available; of these: 4077506 (13.17%) trimmed reads available after processing 26883693 (86.83%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1794 0.01% 19 2853 0.01% 20 3906 0.01% 21 5091 0.02% 22 7135 0.02% 23 10670 0.03% 24 13718 0.04% 25 17696 0.06% 26 17188 0.06% 27 17297 0.06% 28 17737 0.06% 29 18070 0.06% 30 18844 0.06% 31 19295 0.06% 32 19606 0.06% 33 19670 0.06% 34 20134 0.07% 35 20607 0.07% 36 21877 0.07% 37 22190 0.07% 38 23105 0.07% 39 23428 0.08% 40 24376 0.08% 41 25569 0.08% 42 26432 0.09% 43 27397 0.09% 44 28523 0.09% 45 28922 0.09% 46 29749 0.10% 47 30754 0.10% 48 31748 0.10% 49 32251 0.10% 50 32414 0.10% 51 33205 0.11% 52 33590 0.11% 53 34756 0.11% 54 34552 0.11% 55 33913 0.11% 56 35137 0.11% 57 35082 0.11% 58 35461 0.11% 59 36102 0.12% 60 36235 0.12% 61 35919 0.12% 62 36583 0.12% 63 37633 0.12% 64 39337 0.13% 65 41257 0.13% 66 40760 0.13% 67 41730 0.13% 68 42236 0.14% 69 43122 0.14% 70 44991 0.15% 71 45245 0.15% 72 45369 0.15% 73 47252 0.15% 74 47140 0.15% 75 49221 0.16% 76 33939 0.11% 77 38599 0.12% 78 42511 0.14% 79 46660 0.15% 80 48875 0.16% 81 52103 0.17% 82 53951 0.17% 83 56816 0.18% 84 58676 0.19% 85 63616 0.21% 86 65106 0.21% 87 68803 0.22% 88 72776 0.24% 89 79483 0.26% 90 87737 0.28% 91 97441 0.31% 92 109079 0.35% 93 122934 0.40% 94 142734 0.46% 95 168233 0.54% 96 198488 0.64% 97 228638 0.74% 98 243423 0.79% 99 251011 0.81% 100 26883693 86.83% 30961199 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=14.43 fanout-score-rank=8 prefix-density=0.10 prefix-fanout=14.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAGAATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=17 fanout-score=180.02 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=22.3 sequence=AAGAAGAAGAAA Started job on | Feb 10 20:58:50 Started mapping on | Feb 10 20:58:50 Finished on | Feb 10 20:59:18 Mapping speed, Million of reads per hour | 3980.73 Number of input reads | 30961199 Average input read length | 96 UNIQUE READS: Uniquely mapped reads number | 29782072 Uniquely mapped reads % | 96.19% Average mapped length | 96.74 Number of splices: Total | 8353066 Number of splices: Annotated (sjdb) | 8199288 Number of splices: GT/AG | 8231865 Number of splices: GC/AG | 99671 Number of splices: AT/AC | 8016 Number of splices: Non-canonical | 13514 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 702892 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 320782 % of reads mapped to too many loci | 1.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 476235 476235 476235 N_multimapping 702892 702892 702892 N_noFeature 1294515 15331599 15540656 N_ambiguous 305939 50576 51413 UnstrandedReadsAssigned:28181618 PositiveStrandReadsAssigned:14399897 NegativeStrandReadsAssigned:14190003 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207773 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207773-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,961,199 reads, 28,821,033 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52401 SRR3207773.ke.tsv 34699 SRR3207773.se.tsv 87100 total ==> SRR3207773.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 915 24.7726 Potri.005G024800.1.v4.1 1035 936 132 7.32696 Potri.004G059700.1.v4.1 961 862 19 1.14518 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 508.297 9.28568 Potri.016G087400.1.v4.1 270 171 1254.58 381.179 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 110 3.414 Potri.012G127500.1.v4.1 977 878 2108 124.739 ==> SRR3207773.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3194 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 534 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 60 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR3207773 completed mapping pipeline successfully