Starting /dee2/code/volunteer_pipeline.sh SRR3207774 current disk space = 3056210341888 free memory = 1417069380 SRR3207774 SRAfilesize f52543e261ed9f255bb5216efb8c8668 SRR3207774.sra SRR3207774.sra file validated SRR3207774 is single end SRR3207774 is conventional basespace SRR3207774 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207774_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.23625 33.0 31.0 34.0 28.0 34.0 2 31.45275 34.0 31.0 34.0 27.0 34.0 3 31.712 34.0 31.0 34.0 28.0 34.0 4 35.88525 37.0 35.0 37.0 35.0 37.0 5 35.70775 37.0 35.0 37.0 33.0 37.0 6 36.03025 37.0 35.0 37.0 35.0 37.0 7 36.03725 37.0 35.0 37.0 35.0 37.0 8 36.14825 37.0 36.0 37.0 35.0 37.0 9 37.95575 39.0 38.0 39.0 35.0 39.0 10-11 37.946 39.0 38.0 39.0 35.0 39.0 12-13 37.844375 39.0 38.0 39.0 35.0 39.0 14-15 39.27525 41.0 39.0 41.0 36.0 41.0 16-17 39.301625 41.0 39.0 41.0 36.0 41.0 18-19 39.113375000000005 40.5 39.0 41.0 35.5 41.0 20-21 39.022625000000005 40.0 39.0 41.0 35.5 41.0 22-23 38.89375 40.0 38.5 41.0 34.5 41.0 24-25 38.782125 40.0 38.0 41.0 34.0 41.0 26-27 38.595124999999996 40.0 38.0 41.0 34.5 41.0 28-29 38.31375 40.0 38.0 41.0 34.0 41.0 30-31 37.933125000000004 40.0 38.0 41.0 33.0 41.0 32-33 37.701875 40.0 38.0 41.0 32.0 41.0 34-35 37.751625000000004 40.0 38.0 41.0 32.5 41.0 36-37 37.739125 40.0 38.0 41.0 32.5 41.0 38-39 37.786375 40.0 38.0 41.0 32.5 41.0 40-41 37.926125 40.0 38.0 41.0 33.0 41.0 42-43 37.826375 40.0 38.0 41.0 33.0 41.0 44-45 37.522 40.0 38.0 41.0 31.5 41.0 46-47 37.302499999999995 40.0 37.5 41.0 31.0 41.0 48-49 36.856624999999994 40.0 37.0 41.0 30.0 41.0 50-51 36.8035 40.0 37.0 41.0 30.0 41.0 52-53 36.60725 40.0 36.5 41.0 29.5 41.0 54-55 36.533375 40.0 36.0 41.0 29.5 41.0 56-57 36.2145 39.5 36.0 41.0 29.0 41.0 58-59 36.03375 39.0 36.0 41.0 28.5 41.0 60-61 35.476 39.0 35.0 40.5 27.0 41.0 62-63 35.070375 38.5 34.0 40.0 26.0 41.0 64-65 34.649125 38.0 34.0 40.0 25.5 41.0 66-67 34.31175 37.5 34.0 40.0 25.0 41.0 68-69 33.849999999999994 37.0 34.0 39.5 23.5 41.0 70-71 33.27675 36.0 33.0 39.0 22.0 40.5 72-73 32.761125 36.0 32.5 39.0 20.5 40.0 74-75 31.974249999999998 35.0 32.0 37.5 16.5 39.0 76-77 30.783625 34.0 30.5 36.0 15.5 39.0 78-79 31.125999999999998 35.0 31.0 36.5 12.5 39.0 80-81 30.657 35.0 31.0 36.0 7.0 37.0 82-83 29.843625 34.5 29.5 35.5 3.5 37.0 84-85 29.655 34.0 30.0 35.0 2.0 36.5 86-87 29.351875 34.0 29.5 35.0 2.0 36.0 88-89 29.07975 34.0 29.5 35.0 2.0 36.0 90-91 28.883625000000002 34.0 29.0 35.0 2.0 35.5 92-93 28.522750000000002 34.0 29.0 35.0 2.0 35.0 94-95 28.280625 34.0 29.0 35.0 2.0 35.0 96-97 27.36175 34.0 27.0 35.0 2.0 35.0 98-99 26.760375 34.0 25.0 35.0 2.0 35.0 100 26.6955 34.0 25.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 2.0 8 2.0 9 2.0 10 12.0 11 10.0 12 14.0 13 16.0 14 19.0 15 18.0 16 12.0 17 22.0 18 24.0 19 24.0 20 30.0 21 21.0 22 21.0 23 23.0 24 39.0 25 46.0 26 39.0 27 46.0 28 59.0 29 78.0 30 74.0 31 111.0 32 129.0 33 141.0 34 223.0 35 241.0 36 440.0 37 829.0 38 1051.0 39 181.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.068685776095187 14.818820984315847 17.333693888588424 40.778799351000536 2 19.125 23.0 37.325 20.549999999999997 3 21.325 27.575 28.249999999999996 22.85 4 24.325 34.125 20.150000000000002 21.4 5 24.099999999999998 36.05 21.575 18.275 6 18.175 38.05 24.125 19.650000000000002 7 15.975 18.825 45.25 19.950000000000003 8 19.35 23.925 30.349999999999998 26.375 9 19.575 25.3 31.2 23.925 10-11 22.825 34.8375 21.95 20.3875 12-13 19.9625 27.3 30.175 22.5625 14-15 21.0625 27.875 29.037499999999998 22.025 16-17 21.85 28.4 28.537499999999998 21.212500000000002 18-19 21.6875 29.1625 27.775 21.375 20-21 20.625 28.449999999999996 28.512500000000003 22.412499999999998 22-23 21.4875 28.8375 27.525 22.15 24-25 20.474999999999998 28.549999999999997 28.825 22.15 26-27 21.8875 28.675 27.712500000000002 21.725 28-29 21.9375 27.487499999999997 27.6875 22.8875 30-31 21.775 27.962500000000002 28.8875 21.375 32-33 21.1875 28.7375 27.6 22.475 34-35 22.225 27.700000000000003 27.8625 22.2125 36-37 21.6625 28.775000000000002 27.437499999999996 22.125 38-39 21.625 28.462500000000002 26.775 23.1375 40-41 21.712500000000002 28.675 28.487499999999997 21.125 42-43 22.2 27.6875 27.2625 22.85 44-45 21.875 28.1375 28.075 21.912499999999998 46-47 22.225 29.45 26.8375 21.4875 48-49 21.95 28.287499999999998 27.4125 22.35 50-51 22.090261282660332 28.54106763345418 27.353419177397175 22.015251906488313 52-53 21.675 27.750000000000004 28.225 22.35 54-55 21.5375 28.575 27.675 22.2125 56-57 22.65849693635113 27.372764786795052 27.38526947605352 22.5834688008003 58-59 22.175 28.549999999999997 28.012500000000003 21.2625 60-61 22.2125 28.487499999999997 27.150000000000002 22.15 62-63 21.975 27.85 28.1125 22.0625 64-65 21.637500000000003 28.537499999999998 27.925 21.9 66-67 21.825 27.775 27.925 22.475 68-69 21.875 27.825 28.462500000000002 21.837500000000002 70-71 21.2625 28.7 28.0625 21.975 72-73 21.952744093011624 28.453556694586823 27.903487935992 21.690211276409553 74-75 22.30278784848106 28.028503562945367 27.87848481060132 21.790223777972244 76-77 22.665832290362953 27.571964956195245 28.6107634543179 21.151439299123904 78-79 22.280570142535634 27.35683920980245 27.70692673168292 22.655663915978995 80-81 21.77772221527691 26.778347293411674 28.19102387798475 23.252906613326665 82-83 21.9375 28.237499999999997 28.3125 21.512500000000003 84-85 21.45268158519815 28.366045755719465 28.653581697712216 21.527690961370173 86-87 22.0125 27.712500000000002 28.675 21.6 88-89 21.45 28.675 28.237499999999997 21.637500000000003 90-91 21.4125 27.0 28.762500000000003 22.825 92-93 22.025 28.1375 28.175 21.6625 94-95 22.1375 27.2625 28.8875 21.712500000000002 96-97 22.1875 28.95 27.3625 21.5 98-99 21.627703462932867 27.84098012251531 28.166020752594072 22.365295661957745 100 22.330582645661416 26.93173293323331 27.731932983245812 23.005751437859466 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 2.0 25 4.5 26 6.0 27 6.5 28 13.5 29 18.5 30 15.0 31 21.0 32 42.0 33 51.5 34 60.5 35 82.5 36 104.5 37 124.0 38 146.5 39 174.0 40 202.0 41 238.5 42 241.5 43 230.0 44 255.0 45 278.5 46 258.5 47 239.0 48 227.0 49 197.0 50 169.5 51 134.0 52 102.5 53 78.5 54 60.5 55 44.5 56 30.0 57 24.0 58 19.0 59 12.5 60 10.0 61 10.5 62 9.0 63 8.5 64 9.5 65 7.5 66 6.0 67 3.0 68 0.5 69 1.5 70 2.5 71 1.5 72 0.0 73 0.5 74 1.5 75 1.0 76 1.0 77 1.0 78 1.5 79 1.5 80 0.0 81 0.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0125 52-53 0.0 54-55 0.0 56-57 0.0375 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0125 76-77 0.125 78-79 0.025 80-81 0.0125 82-83 0.0 84-85 0.0125 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945413 spots for SRR3207774.sra Written 1945413 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra Read 1945404 spots for SRR3207774.sra Written 1945404 spots for SRR3207774.sra SRR ids: ['SRR3207774.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dzsbwzm9 SRR3207774.sra spots: 38908089 blocks: [[1, 1945404], [1945405, 3890808], [3890809, 5836212], [5836213, 7781616], [7781617, 9727020], [9727021, 11672424], [11672425, 13617828], [13617829, 15563232], [15563233, 17508636], [17508637, 19454040], [19454041, 21399444], [21399445, 23344848], [23344849, 25290252], [25290253, 27235656], [27235657, 29181060], [29181061, 31126464], [31126465, 33071868], [33071869, 35017272], [35017273, 36962676], [36962677, 38908089]] SRR3207774 file size 10114516 SRR3207774 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207774 SRR3207774_1.fastq Input file: SRR3207774_1.fastq trimmed: SRR3207774-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:47:08 2025 >> started Mon Feb 10 20:47:39 2025 >> done (31.076s) 38908089 reads processed; of these: 8537 ( 0.02%) short reads filtered out after trimming by size control 13317 ( 0.03%) empty reads filtered out after trimming by size control 38886235 (99.94%) reads available; of these: 5197562 (13.37%) trimmed reads available after processing 33688673 (86.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2309 0.01% 19 3437 0.01% 20 4880 0.01% 21 6263 0.02% 22 8934 0.02% 23 13160 0.03% 24 17137 0.04% 25 21969 0.06% 26 21676 0.06% 27 21808 0.06% 28 22273 0.06% 29 22819 0.06% 30 23393 0.06% 31 24193 0.06% 32 24610 0.06% 33 24899 0.06% 34 25598 0.07% 35 25882 0.07% 36 27474 0.07% 37 28187 0.07% 38 29004 0.07% 39 29449 0.08% 40 30505 0.08% 41 31928 0.08% 42 32961 0.08% 43 34720 0.09% 44 35908 0.09% 45 36871 0.09% 46 37594 0.10% 47 38454 0.10% 48 39598 0.10% 49 40787 0.10% 50 41085 0.11% 51 42038 0.11% 52 42546 0.11% 53 43616 0.11% 54 43658 0.11% 55 43377 0.11% 56 44866 0.12% 57 44844 0.12% 58 44655 0.11% 59 45942 0.12% 60 46258 0.12% 61 46079 0.12% 62 47642 0.12% 63 47724 0.12% 64 49409 0.13% 65 50528 0.13% 66 52239 0.13% 67 54035 0.14% 68 55307 0.14% 69 54931 0.14% 70 57473 0.15% 71 57666 0.15% 72 58694 0.15% 73 60200 0.15% 74 60717 0.16% 75 63253 0.16% 76 43711 0.11% 77 49315 0.13% 78 54720 0.14% 79 59755 0.15% 80 62826 0.16% 81 66693 0.17% 82 69197 0.18% 83 73169 0.19% 84 75406 0.19% 85 80706 0.21% 86 83484 0.21% 87 87847 0.23% 88 94185 0.24% 89 101107 0.26% 90 112577 0.29% 91 125800 0.32% 92 140106 0.36% 93 157248 0.40% 94 182950 0.47% 95 215271 0.55% 96 253480 0.65% 97 290545 0.75% 98 309587 0.80% 99 320415 0.82% 100 33688673 86.63% 38886235 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=48.65 fanout-score-rank=7 prefix-density=0.53 prefix-fanout=35.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAACAATCTCGTATGCCGTCTTCTGCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=6 fanout-score=174.99 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=23.7 sequence=AAGAAGAAGAAA Started job on | Feb 10 20:48:10 Started mapping on | Feb 10 20:48:11 Finished on | Feb 10 20:48:59 Mapping speed, Million of reads per hour | 2916.47 Number of input reads | 38886235 Average input read length | 96 UNIQUE READS: Uniquely mapped reads number | 37581132 Uniquely mapped reads % | 96.64% Average mapped length | 96.57 Number of splices: Total | 10757824 Number of splices: Annotated (sjdb) | 10557033 Number of splices: GT/AG | 10601975 Number of splices: GC/AG | 127601 Number of splices: AT/AC | 10631 Number of splices: Non-canonical | 17617 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 869654 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 236718 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 435449 435449 435449 N_multimapping 869654 869654 869654 N_noFeature 1653579 19358346 19606067 N_ambiguous 397580 63000 64773 UnstrandedReadsAssigned:35529973 PositiveStrandReadsAssigned:18159786 NegativeStrandReadsAssigned:17910292 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207774 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207774-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,886,235 reads, 36,201,018 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52401 SRR3207774.ke.tsv 34699 SRR3207774.se.tsv 87100 total ==> SRR3207774.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1178 27.006 Potri.005G024800.1.v4.1 1035 936 183 8.60132 Potri.004G059700.1.v4.1 961 862 20 1.02073 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 663.68 10.2664 Potri.016G087400.1.v4.1 270 171 1211.58 311.708 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 96.5008 2.5361 Potri.012G127500.1.v4.1 977 878 2075 103.971 ==> SRR3207774.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3430 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 583 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 69 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR3207774 completed mapping pipeline successfully