Starting /dee2/code/volunteer_pipeline.sh SRR3207775 current disk space = 3056241049600 free memory = 1382592244 SRR3207775 SRAfilesize 36e245fcec892bd6e26481ac2639251c SRR3207775.sra SRR3207775.sra file validated SRR3207775 is single end SRR3207775 is conventional basespace SRR3207775 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207775_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.75625 34.0 31.0 34.0 30.0 34.0 2 31.687 34.0 31.0 34.0 30.0 34.0 3 31.7135 34.0 31.0 34.0 28.0 34.0 4 35.9545 37.0 35.0 37.0 35.0 37.0 5 35.6745 37.0 35.0 37.0 33.0 37.0 6 36.1175 37.0 35.0 37.0 35.0 37.0 7 36.11 37.0 35.0 37.0 35.0 37.0 8 36.201 37.0 36.0 37.0 35.0 37.0 9 38.04975 39.0 38.0 39.0 35.0 39.0 10-11 37.98975 39.0 38.0 39.0 35.0 39.0 12-13 37.949875000000006 39.0 38.0 39.0 35.0 39.0 14-15 39.328 41.0 39.0 41.0 36.0 41.0 16-17 39.373000000000005 41.0 39.0 41.0 36.0 41.0 18-19 39.226875 41.0 39.0 41.0 36.0 41.0 20-21 39.101625 40.0 39.0 41.0 36.0 41.0 22-23 38.909125 40.0 38.5 41.0 35.5 41.0 24-25 38.804 40.0 38.0 41.0 34.5 41.0 26-27 38.64975 40.0 38.0 41.0 34.5 41.0 28-29 38.3975 40.0 38.0 41.0 34.0 41.0 30-31 38.115750000000006 40.0 38.0 41.0 33.0 41.0 32-33 37.922 40.0 38.0 41.0 33.0 41.0 34-35 37.858125 40.0 38.0 41.0 33.0 41.0 36-37 37.924499999999995 40.0 38.0 41.0 33.0 41.0 38-39 37.997 40.0 38.0 41.0 33.0 41.0 40-41 38.132875 40.0 38.0 41.0 33.0 41.0 42-43 37.948 40.0 38.0 41.0 33.0 41.0 44-45 37.71 40.0 38.0 41.0 32.0 41.0 46-47 37.5975 40.0 38.0 41.0 32.5 41.0 48-49 37.094625 40.0 37.0 41.0 31.0 41.0 50-51 37.049875 40.0 37.0 41.0 31.0 41.0 52-53 36.839875 40.0 37.0 41.0 30.5 41.0 54-55 36.747125 40.0 36.5 41.0 30.5 41.0 56-57 36.441375 39.5 36.0 41.0 29.0 41.0 58-59 36.141625000000005 39.0 36.0 41.0 28.5 41.0 60-61 35.6405 39.0 35.0 40.5 28.0 41.0 62-63 35.282250000000005 38.5 34.5 40.0 27.0 41.0 64-65 34.899 38.0 34.0 40.0 26.0 41.0 66-67 34.61150000000001 37.5 34.0 40.0 26.0 41.0 68-69 34.07475 37.0 34.0 39.5 25.5 41.0 70-71 33.7265 36.5 34.0 39.0 25.5 41.0 72-73 33.041 36.0 33.0 39.0 22.5 40.0 74-75 32.235 35.0 32.0 37.5 20.0 39.5 76-77 31.05075 34.5 30.5 36.5 18.0 39.0 78-79 31.50825 35.0 31.5 37.0 19.0 39.0 80-81 31.051125 35.0 31.5 36.0 15.5 37.5 82-83 30.275875 34.5 30.5 35.5 9.5 37.0 84-85 29.93025 34.0 30.0 35.0 7.0 37.0 86-87 29.676125 34.0 30.0 35.0 3.5 36.0 88-89 29.447625000000002 34.0 30.0 35.0 2.0 36.0 90-91 29.283625 34.0 30.0 35.0 2.0 35.5 92-93 28.760125000000002 34.0 29.0 35.0 2.0 35.0 94-95 28.608125 34.0 29.0 35.0 2.0 35.0 96-97 27.784 34.0 27.0 35.0 2.0 35.0 98-99 27.199375 34.0 26.5 35.0 2.0 35.0 100 27.12225 34.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 4.0 10 9.0 11 10.0 12 12.0 13 7.0 14 18.0 15 14.0 16 22.0 17 14.0 18 16.0 19 28.0 20 16.0 21 17.0 22 33.0 23 38.0 24 24.0 25 33.0 26 48.0 27 53.0 28 49.0 29 60.0 30 79.0 31 104.0 32 132.0 33 155.0 34 194.0 35 266.0 36 444.0 37 837.0 38 1060.0 39 202.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.84871044934858 16.19250199415049 18.160063812815743 36.798723743685194 2 20.05 24.5 35.075 20.375 3 21.375 28.025 28.075 22.525000000000002 4 24.099999999999998 34.575 20.075000000000003 21.25 5 24.825 37.15 20.7 17.325 6 18.95 38.324999999999996 23.625 19.1 7 16.0 18.025 44.224999999999994 21.75 8 18.975 24.25 28.449999999999996 28.325 9 19.900000000000002 24.425 30.0 25.674999999999997 10-11 22.475 35.0375 22.3125 20.175 12-13 19.650000000000002 26.5125 30.875000000000004 22.9625 14-15 21.325 27.5625 29.5 21.6125 16-17 21.6125 28.175 27.6 22.6125 18-19 21.075 29.0875 28.175 21.6625 20-21 21.9625 28.3375 28.050000000000004 21.65 22-23 21.875 27.9375 27.35 22.8375 24-25 20.8875 29.5875 27.625 21.9 26-27 20.849999999999998 29.825000000000003 26.825 22.5 28-29 21.912499999999998 28.287499999999998 27.700000000000003 22.1 30-31 21.75 29.0875 27.55 21.6125 32-33 21.637500000000003 28.1625 27.1 23.1 34-35 22.225 28.65 27.450000000000003 21.675 36-37 21.099999999999998 28.075 28.025 22.8 38-39 22.05 28.462500000000002 27.525 21.9625 40-41 21.875 28.875 27.6375 21.6125 42-43 21.45 28.3625 28.3125 21.875 44-45 22.400000000000002 28.4125 27.800000000000004 21.3875 46-47 21.475 29.212500000000002 27.3375 21.975 48-49 21.375 28.3375 28.775000000000002 21.512500000000003 50-51 22.665333166645834 28.391048881110137 27.728466058257283 21.215151893986747 52-53 22.037499999999998 29.1625 26.6625 22.1375 54-55 21.65 27.8375 28.575 21.9375 56-57 21.552694086760845 28.60357544693087 28.003500437554695 21.840230028753595 58-59 21.25 28.425 28.775000000000002 21.55 60-61 21.0625 28.175 28.3125 22.45 62-63 22.037499999999998 28.5875 27.375 22.0 64-65 21.9375 28.6625 27.450000000000003 21.95 66-67 21.85 27.900000000000002 27.8625 22.3875 68-69 22.1 28.3875 27.987499999999997 21.525 70-71 22.275 27.8375 27.8625 22.025 72-73 21.980495123780948 28.232058014503625 27.74443610902726 22.043010752688172 74-75 21.477684710588825 28.653581697712216 28.653581697712216 21.215151893986747 76-77 22.2806358743272 28.41406934534986 27.537864563775187 21.767430216547755 78-79 21.780445111277817 27.51937984496124 28.782195548887223 21.91797949487372 80-81 22.73068267066767 28.107026756689173 27.25681420355089 21.905476369092273 82-83 22.06525815726966 28.078509813726715 28.653581697712216 21.202650331291412 84-85 21.702712839104887 28.141017627203404 28.441055131891485 21.715214401800225 86-87 21.41517689711214 28.94111763970496 28.091011376422053 21.552694086760845 88-89 21.9625 28.599999999999998 27.875 21.5625 90-91 22.35 27.85 28.025 21.775 92-93 22.475 28.4 27.6125 21.512500000000003 94-95 22.2 28.299999999999997 27.425 22.075 96-97 23.1375 27.05 27.712500000000002 22.1 98-99 21.540192524065507 28.378547318414803 28.54106763345418 21.540192524065507 100 22.155538884721178 27.38184546136534 27.25681420355089 23.20580145036259 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 3.5 25 3.5 26 3.5 27 7.0 28 9.0 29 13.5 30 18.5 31 25.5 32 38.0 33 48.0 34 64.0 35 80.5 36 94.0 37 123.0 38 162.5 39 187.5 40 209.0 41 237.0 42 257.0 43 267.5 44 259.0 45 243.0 46 239.0 47 241.5 48 227.0 49 198.5 50 159.0 51 118.5 52 96.5 53 78.5 54 64.5 55 45.5 56 37.5 57 32.5 58 19.5 59 13.0 60 10.5 61 8.5 62 9.0 63 9.0 64 4.5 65 3.5 66 2.5 67 4.0 68 4.5 69 2.5 70 1.0 71 0.5 72 3.0 73 2.5 74 0.5 75 1.5 76 2.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0125 52-53 0.0 54-55 0.0 56-57 0.0125 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.025 74-75 0.0125 76-77 0.13749999999999998 78-79 0.025 80-81 0.025 82-83 0.0125 84-85 0.0125 86-87 0.0125 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0125 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392843 spots for SRR3207775.sra Written 1392843 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra Read 1392836 spots for SRR3207775.sra Written 1392836 spots for SRR3207775.sra SRR ids: ['SRR3207775.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tuimrrhw SRR3207775.sra spots: 27856727 blocks: [[1, 1392836], [1392837, 2785672], [2785673, 4178508], [4178509, 5571344], [5571345, 6964180], [6964181, 8357016], [8357017, 9749852], [9749853, 11142688], [11142689, 12535524], [12535525, 13928360], [13928361, 15321196], [15321197, 16714032], [16714033, 18106868], [18106869, 19499704], [19499705, 20892540], [20892541, 22285376], [22285377, 23678212], [23678213, 25071048], [25071049, 26463884], [26463885, 27856727]] SRR3207775 file size 7238531 SRR3207775 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207775 SRR3207775_1.fastq Input file: SRR3207775_1.fastq trimmed: SRR3207775-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 20:49:45 2025 >> started Mon Feb 10 20:50:00 2025 >> done (14.722s) 27856727 reads processed; of these: 5453 ( 0.02%) short reads filtered out after trimming by size control 21550 ( 0.08%) empty reads filtered out after trimming by size control 27829724 (99.90%) reads available; of these: 3666849 (13.18%) trimmed reads available after processing 24162875 (86.82%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1637 0.01% 19 2471 0.01% 20 3312 0.01% 21 4464 0.02% 22 6383 0.02% 23 9614 0.03% 24 12085 0.04% 25 15527 0.06% 26 15180 0.05% 27 15439 0.06% 28 15997 0.06% 29 16267 0.06% 30 17012 0.06% 31 17345 0.06% 32 17602 0.06% 33 17694 0.06% 34 18295 0.07% 35 18618 0.07% 36 19737 0.07% 37 20183 0.07% 38 20871 0.07% 39 20933 0.08% 40 21602 0.08% 41 22702 0.08% 42 23608 0.08% 43 24651 0.09% 44 25363 0.09% 45 25833 0.09% 46 26625 0.10% 47 27530 0.10% 48 28383 0.10% 49 28346 0.10% 50 29080 0.10% 51 30215 0.11% 52 29881 0.11% 53 30863 0.11% 54 30585 0.11% 55 30743 0.11% 56 31519 0.11% 57 31347 0.11% 58 31546 0.11% 59 32513 0.12% 60 32176 0.12% 61 32289 0.12% 62 33187 0.12% 63 33105 0.12% 64 34603 0.12% 65 35376 0.13% 66 36271 0.13% 67 37097 0.13% 68 37805 0.14% 69 38602 0.14% 70 40349 0.14% 71 40636 0.15% 72 40644 0.15% 73 42453 0.15% 74 42666 0.15% 75 44691 0.16% 76 30640 0.11% 77 34717 0.12% 78 38359 0.14% 79 41574 0.15% 80 43865 0.16% 81 46900 0.17% 82 48584 0.17% 83 51236 0.18% 84 53203 0.19% 85 56833 0.20% 86 58818 0.21% 87 61925 0.22% 88 65668 0.24% 89 71792 0.26% 90 78267 0.28% 91 87443 0.31% 92 99020 0.36% 93 111803 0.40% 94 128095 0.46% 95 151603 0.54% 96 179502 0.65% 97 206390 0.74% 98 220208 0.79% 99 228853 0.82% 100 24162875 86.82% 27829724 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=7.52 fanout-score-rank=13 prefix-density=0.05 prefix-fanout=7.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=180.09 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=22.7 sequence=AAGAAGAAGAAA Started job on | Feb 10 20:50:21 Started mapping on | Feb 10 20:50:21 Finished on | Feb 10 20:50:48 Mapping speed, Million of reads per hour | 3710.63 Number of input reads | 27829724 Average input read length | 96 UNIQUE READS: Uniquely mapped reads number | 26828430 Uniquely mapped reads % | 96.40% Average mapped length | 96.74 Number of splices: Total | 7463957 Number of splices: Annotated (sjdb) | 7328994 Number of splices: GT/AG | 7357797 Number of splices: GC/AG | 87543 Number of splices: AT/AC | 7071 Number of splices: Non-canonical | 11546 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 611874 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 260670 % of reads mapped to too many loci | 0.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 389420 389420 389420 N_multimapping 611874 611874 611874 N_noFeature 1151470 13809247 13977770 N_ambiguous 280867 43723 44596 UnstrandedReadsAssigned:25396093 PositiveStrandReadsAssigned:12975460 NegativeStrandReadsAssigned:12806064 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR3207775 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207775-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,829,724 reads, 25,942,172 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR3207775.ke.tsv 34699 SRR3207775.se.tsv 87100 total ==> SRR3207775.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 738 22.3615 Potri.005G024800.1.v4.1 1035 936 74 4.59702 Potri.004G059700.1.v4.1 961 862 15 1.01182 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 422.719 8.64255 Potri.016G087400.1.v4.1 270 171 1049 356.697 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 67 2.32723 Potri.012G127500.1.v4.1 977 878 2009 133.047 ==> SRR3207775.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2260 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 397 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 62 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207775 completed mapping pipeline successfully