Starting /dee2/code/volunteer_pipeline.sh SRR3207776 current disk space = 3056995549184 free memory = 1576481368 SRR3207776 SRAfilesize eb32e858e323609dd4ab1d8d901c8f4a SRR3207776.sra SRR3207776.sra file validated SRR3207776 is single end SRR3207776 is conventional basespace SRR3207776 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207776_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.2835 39.0 38.0 40.0 33.0 40.0 2 36.90925 39.0 36.0 40.0 33.0 40.0 3 37.0335 39.0 37.0 40.0 33.0 40.0 4 37.02 39.0 37.0 40.0 33.0 40.0 5 36.9575 39.0 37.0 40.0 33.0 40.0 6 37.07075 39.0 36.0 40.0 33.0 40.0 7 37.0305 39.0 36.0 40.0 33.0 40.0 8 36.9355 39.0 36.0 40.0 32.0 40.0 9 36.78275 39.0 36.0 40.0 31.0 40.0 10 36.87275 39.0 36.0 40.0 32.0 40.0 11 36.9915 39.0 36.0 40.0 32.0 40.0 12 37.01625 38.0 36.0 40.0 31.0 40.0 13 36.89925 38.0 36.0 40.0 31.0 40.0 14 36.84375 38.0 36.0 40.0 31.0 40.0 15 36.851 38.0 36.0 40.0 31.0 40.0 16 36.92675 39.0 36.0 40.0 32.0 40.0 17 36.8265 38.0 36.0 40.0 31.0 40.0 18 36.683 38.0 35.0 40.0 31.0 40.0 19 36.625 38.0 35.0 40.0 31.0 40.0 20 36.50625 38.0 35.0 40.0 31.0 40.0 21 36.4015 38.0 35.0 40.0 31.0 40.0 22 36.32875 38.0 35.0 39.0 31.0 40.0 23 36.3045 38.0 35.0 39.0 31.0 40.0 24 36.113 38.0 35.0 39.0 30.0 40.0 25 36.078 38.0 35.0 39.0 30.0 40.0 26 35.867 38.0 35.0 39.0 30.0 40.0 27 35.67975 38.0 35.0 39.0 29.0 40.0 28 35.60325 38.0 35.0 39.0 29.0 40.0 29 35.394 38.0 34.0 39.0 29.0 40.0 30 35.26475 38.0 34.0 39.0 28.0 40.0 31 35.536 38.0 35.0 39.0 29.0 40.0 32 35.394 38.0 35.0 39.0 29.0 40.0 33 35.5245 38.0 35.0 39.0 29.0 40.0 34 35.27625 38.0 34.0 39.0 29.0 40.0 35 35.25225 38.0 34.0 39.0 28.0 40.0 36 35.6465 38.0 35.0 39.0 30.0 40.0 37 35.40375 38.0 35.0 39.0 29.0 40.0 38 35.34975 38.0 34.0 39.0 29.0 40.0 39 35.223 38.0 34.0 39.0 28.0 40.0 40 35.1835 38.0 34.0 39.0 29.0 40.0 41 34.9055 38.0 34.0 39.0 28.0 40.0 42 34.77 38.0 34.0 39.0 28.0 40.0 43 34.58625 38.0 33.0 39.0 27.0 40.0 44 34.47875 37.0 33.0 39.0 27.0 40.0 45 34.23225 37.0 33.0 39.0 27.0 40.0 46 34.0955 37.0 33.0 39.0 26.0 40.0 47 33.981 37.0 33.0 39.0 26.0 40.0 48 33.70925 36.0 33.0 39.0 25.0 40.0 49 33.51075 36.0 33.0 39.0 24.0 40.0 50 33.26575 36.0 33.0 39.0 23.0 40.0 51 33.11025 36.0 33.0 39.0 23.0 40.0 52 32.77625 36.0 32.0 39.0 23.0 39.0 53 32.73125 36.0 32.0 39.0 23.0 39.0 54 32.554 36.0 32.0 38.0 23.0 39.0 55 32.34475 36.0 32.0 38.0 22.0 39.0 56 31.87575 35.0 31.0 38.0 18.0 39.0 57 31.72275 35.0 31.0 38.0 18.0 39.0 58 31.57575 35.0 31.0 38.0 17.0 39.0 59 31.21925 35.0 30.0 38.0 14.0 39.0 60 31.00175 35.0 30.0 38.0 11.0 39.0 61 30.578 35.0 30.0 38.0 2.0 39.0 62 30.2435 34.0 30.0 38.0 2.0 39.0 63 29.90625 34.0 29.0 37.0 2.0 39.0 64 29.588 34.0 29.0 37.0 2.0 39.0 65 29.14275 33.0 29.0 36.0 2.0 39.0 66 28.87125 34.0 29.0 36.0 2.0 39.0 67 28.493 33.0 27.0 36.0 2.0 39.0 68 27.80225 33.0 26.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 5.0 9 7.0 10 5.0 11 6.0 12 7.0 13 12.0 14 13.0 15 10.0 16 12.0 17 22.0 18 24.0 19 10.0 20 23.0 21 14.0 22 38.0 23 33.0 24 40.0 25 47.0 26 52.0 27 69.0 28 79.0 29 74.0 30 88.0 31 121.0 32 138.0 33 203.0 34 254.0 35 361.0 36 459.0 37 641.0 38 687.0 39 435.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.56543837357052 14.73951715374841 17.433290978398983 42.26175349428208 2 19.225 25.35 36.15 19.275000000000002 3 21.825 29.65 26.5 22.025 4 23.625 34.375 20.175 21.825 5 23.875 36.25 22.6 17.275 6 17.825 37.6 24.474999999999998 20.1 7 15.174999999999999 17.2 45.9 21.725 8 20.349999999999998 22.025 29.325000000000003 28.299999999999997 9 19.825 22.725 31.324999999999996 26.125 10 19.825 38.2 24.224999999999998 17.75 11 25.900000000000002 26.55 21.25 26.3 12 21.25 23.95 29.549999999999997 25.25 13 18.3 28.549999999999997 31.65 21.5 14 21.075 26.325 30.4 22.2 15 21.5 27.725 27.450000000000003 23.325000000000003 16 21.425 27.6 27.950000000000003 23.025000000000002 17 22.325 28.025 26.85 22.8 18 21.175 27.525 27.800000000000004 23.5 19 21.975 28.075 27.224999999999998 22.725 20 21.625 28.525 28.225 21.625 21 20.8 27.750000000000004 27.950000000000003 23.5 22 21.2 29.575000000000003 28.525 20.7 23 22.400000000000002 28.749999999999996 27.750000000000004 21.099999999999998 24 21.525 27.375 29.299999999999997 21.8 25 21.6 28.749999999999996 27.800000000000004 21.85 26 21.725 28.15 28.65 21.475 27 20.625 28.925 27.3 23.150000000000002 28 21.7 28.025 28.299999999999997 21.975 29 21.224999999999998 29.825000000000003 27.575 21.375 30 22.375 28.4 27.6 21.625 31 20.730182545636406 29.707426856714182 28.232058014503625 21.330332583145786 32 20.560280140070038 30.040020010005 27.66383191595798 21.735867933966986 33 22.650000000000002 27.200000000000003 27.750000000000004 22.400000000000002 34 21.525 30.025000000000002 26.674999999999997 21.775 35 21.349999999999998 28.125 28.549999999999997 21.975 36 21.125 27.6 28.15 23.125 37 23.075000000000003 27.750000000000004 28.1 21.075 38 22.311155577788895 28.189094547273637 27.788894447223612 21.710855427713856 39 20.65 27.800000000000004 28.849999999999998 22.7 40 21.05 28.025 28.175 22.75 41 21.3 28.225 27.85 22.625 42 21.625 27.975 28.549999999999997 21.85 43 21.775 27.875 27.800000000000004 22.55 44 22.075 28.575 27.400000000000002 21.95 45 21.373089451265347 26.910548734652966 28.48910047607116 23.227261338010525 46 21.775 27.950000000000003 28.15 22.125 47 21.875 28.425 28.000000000000004 21.7 48 23.025000000000002 26.700000000000003 27.125 23.150000000000002 49 20.275000000000002 29.4 28.95 21.375 50 23.575 26.375 28.299999999999997 21.75 51 21.05 26.35 29.15 23.45 52 22.725 27.025 27.575 22.675 53 21.175 28.799999999999997 27.950000000000003 22.075 54 21.925 27.975 27.474999999999998 22.625 55 21.55 28.65 28.125 21.675 56 22.45 27.575 27.925 22.05 57 20.005001250312578 29.457364341085274 28.832208052013 21.705426356589147 58 22.075 27.975 27.375 22.575 59 23.175 28.675 27.224999999999998 20.925 60 22.2 28.025 27.6 22.175 61 21.975 26.8 28.475 22.75 62 22.73068267066767 28.257064266066518 27.131782945736433 21.880470117529384 63 21.75 29.099999999999998 28.175 20.974999999999998 64 22.125 28.449999999999996 27.825 21.6 65 22.5 28.175 27.775 21.55 66 22.55 28.575 27.425 21.45 67 21.725 27.1 29.275000000000002 21.9 68 23.849999999999998 27.625 26.974999999999998 21.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 3.5 24 7.0 25 9.0 26 10.5 27 22.5 28 33.0 29 40.5 30 48.0 31 48.0 32 68.5 33 97.5 34 106.0 35 123.5 36 161.5 37 182.0 38 207.0 39 250.5 40 302.0 41 335.0 42 331.5 43 347.5 44 367.0 45 347.0 46 326.5 47 326.0 48 290.5 49 243.0 50 231.0 51 205.5 52 159.5 53 139.0 54 127.0 55 98.0 56 81.0 57 60.5 58 38.0 59 36.0 60 28.5 61 16.0 62 11.0 63 9.0 64 6.0 65 2.5 66 0.0 67 0.5 68 3.0 69 5.0 70 3.5 71 2.5 72 3.0 73 3.5 74 2.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.025 32 0.05 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.05 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.22499999999999998 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.025 58 0.0 59 0.0 60 0.0 61 0.0 62 0.025 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399687 spots for SRR3207776.sra Written 399687 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra Read 399672 spots for SRR3207776.sra Written 399672 spots for SRR3207776.sra SRR ids: ['SRR3207776.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xd3cp4z7 SRR3207776.sra spots: 7993455 blocks: [[1, 399672], [399673, 799344], [799345, 1199016], [1199017, 1598688], [1598689, 1998360], [1998361, 2398032], [2398033, 2797704], [2797705, 3197376], [3197377, 3597048], [3597049, 3996720], [3996721, 4396392], [4396393, 4796064], [4796065, 5195736], [5195737, 5595408], [5595409, 5995080], [5995081, 6394752], [6394753, 6794424], [6794425, 7194096], [7194097, 7593768], [7593769, 7993455]] SRR3207776 file size 1678708 SRR3207776 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207776 SRR3207776_1.fastq Input file: SRR3207776_1.fastq trimmed: SRR3207776-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:53:17 2025 >> started Mon Feb 10 21:53:21 2025 >> done (3.713s) 7993455 reads processed; of these: 9946 ( 0.12%) short reads filtered out after trimming by size control 7725 ( 0.10%) empty reads filtered out after trimming by size control 7975784 (99.78%) reads available; of these: 885604 (11.10%) trimmed reads available after processing 7090180 (88.90%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1643 0.02% 19 2802 0.04% 20 4827 0.06% 21 1662 0.02% 22 2327 0.03% 23 3678 0.05% 24 6333 0.08% 25 10703 0.13% 26 2794 0.04% 27 3535 0.04% 28 4734 0.06% 29 7566 0.09% 30 11280 0.14% 31 3310 0.04% 32 4458 0.06% 33 4826 0.06% 34 7828 0.10% 35 12484 0.16% 36 3777 0.05% 37 4962 0.06% 38 7379 0.09% 39 11604 0.15% 40 19023 0.24% 41 4760 0.06% 42 6564 0.08% 43 9680 0.12% 44 16153 0.20% 45 25925 0.33% 46 7019 0.09% 47 9081 0.11% 48 13269 0.17% 49 22554 0.28% 50 37466 0.47% 51 9276 0.12% 52 12140 0.15% 53 17811 0.22% 54 30497 0.38% 55 50100 0.63% 56 12189 0.15% 57 16604 0.21% 58 25085 0.31% 59 42708 0.54% 60 73415 0.92% 61 16932 0.21% 62 23025 0.29% 63 33586 0.42% 64 57008 0.71% 65 92497 1.16% 66 24080 0.30% 67 52645 0.66% 68 7090180 88.90% 7975784 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=10.76 fanout-score-rank=10 prefix-density=0.09 prefix-fanout=4.6 sequence=GCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=137.91 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.8 sequence=CCACCACCAACA Started job on | Feb 10 21:53:36 Started mapping on | Feb 10 21:53:36 Finished on | Feb 10 21:53:44 Mapping speed, Million of reads per hour | 3589.10 Number of input reads | 7975784 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 7548189 Uniquely mapped reads % | 94.64% Average mapped length | 66.41 Number of splices: Total | 1416171 Number of splices: Annotated (sjdb) | 1394009 Number of splices: GT/AG | 1395726 Number of splices: GC/AG | 16791 Number of splices: AT/AC | 1599 Number of splices: Non-canonical | 2055 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264643 % of reads mapped to multiple loci | 3.32% Number of reads mapped to too many loci | 126303 % of reads mapped to too many loci | 1.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 162952 162952 162952 N_multimapping 264643 264643 264643 N_noFeature 344909 3914965 3926029 N_ambiguous 75377 11604 11742 UnstrandedReadsAssigned:7127903 PositiveStrandReadsAssigned:3621620 NegativeStrandReadsAssigned:3610418 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207776 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207776-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,975,784 reads, 7,378,244 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR3207776.ke.tsv 34699 SRR3207776.se.tsv 87100 total ==> SRR3207776.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 270 28.4421 Potri.005G024800.1.v4.1 1035 936 53 11.4465 Potri.004G059700.1.v4.1 961 862 8 1.8761 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 100.91 7.17261 Potri.016G087400.1.v4.1 270 171 268 316.82 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 11 1.32834 Potri.012G127500.1.v4.1 977 878 701 161.398 ==> SRR3207776.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 727 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 135 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207776 completed mapping pipeline successfully