Starting /dee2/code/volunteer_pipeline.sh SRR3207777 current disk space = 3056936189952 free memory = 1475438580 SRR3207777 SRAfilesize b31f7e60722bc657bc7cdf3766080838 SRR3207777.sra SRR3207777.sra file validated SRR3207777 is single end SRR3207777 is conventional basespace SRR3207777 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207777_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.21625 39.0 38.0 40.0 33.0 40.0 2 36.9785 39.0 37.0 40.0 33.0 40.0 3 37.07475 39.0 37.0 40.0 33.0 40.0 4 37.016 39.0 37.0 40.0 33.0 40.0 5 37.067 39.0 37.0 40.0 33.0 40.0 6 37.02125 39.0 36.0 40.0 33.0 40.0 7 37.025 39.0 37.0 40.0 33.0 40.0 8 36.8985 39.0 36.0 40.0 32.0 40.0 9 36.83875 39.0 36.0 40.0 31.0 40.0 10 36.91425 39.0 36.0 40.0 32.0 40.0 11 37.04075 39.0 36.0 40.0 33.0 40.0 12 37.0005 39.0 36.0 40.0 32.0 40.0 13 36.88575 39.0 36.0 40.0 31.0 40.0 14 36.834 38.0 36.0 40.0 31.0 40.0 15 36.89425 39.0 36.0 40.0 31.0 40.0 16 36.85025 39.0 36.0 40.0 31.0 40.0 17 36.72525 38.0 36.0 40.0 31.0 40.0 18 36.64475 38.0 36.0 40.0 31.0 40.0 19 36.638 38.0 35.0 40.0 31.0 40.0 20 36.50475 38.0 35.0 40.0 31.0 40.0 21 36.45425 38.0 35.0 40.0 31.0 40.0 22 36.499 38.0 35.0 40.0 31.0 40.0 23 36.41075 38.0 35.0 40.0 31.0 40.0 24 36.2575 38.0 35.0 40.0 31.0 40.0 25 36.08475 38.0 35.0 39.0 30.0 40.0 26 35.86225 38.0 35.0 39.0 29.0 40.0 27 35.65375 38.0 35.0 39.0 29.0 40.0 28 35.50625 38.0 35.0 39.0 29.0 40.0 29 35.2795 38.0 34.0 39.0 28.0 40.0 30 35.29525 38.0 34.0 39.0 29.0 40.0 31 35.408 38.0 35.0 39.0 29.0 40.0 32 35.22975 38.0 34.0 39.0 28.0 40.0 33 35.4295 38.0 35.0 39.0 29.0 40.0 34 35.232 38.0 34.0 39.0 28.0 40.0 35 35.12825 38.0 34.0 39.0 28.0 40.0 36 35.55875 38.0 35.0 39.0 29.0 40.0 37 35.36875 38.0 35.0 39.0 29.0 40.0 38 35.224 38.0 34.0 39.0 29.0 40.0 39 35.01325 38.0 34.0 39.0 28.0 40.0 40 34.97075 38.0 34.0 39.0 29.0 40.0 41 34.82925 38.0 34.0 39.0 28.0 40.0 42 34.6185 38.0 34.0 39.0 27.0 40.0 43 34.499 38.0 33.0 39.0 27.0 40.0 44 34.535 38.0 33.0 39.0 27.0 40.0 45 34.1755 37.0 33.0 39.0 26.0 40.0 46 34.1955 38.0 33.0 39.0 27.0 40.0 47 34.01775 37.0 33.0 39.0 26.0 40.0 48 33.663 37.0 33.0 39.0 25.0 40.0 49 33.50575 36.0 33.0 39.0 25.0 40.0 50 33.35825 36.0 33.0 39.0 23.0 40.0 51 33.00625 36.0 32.0 39.0 23.0 40.0 52 32.6355 36.0 32.0 39.0 22.0 39.0 53 32.59425 36.0 32.0 39.0 22.0 39.0 54 32.35475 36.0 31.0 39.0 20.0 39.0 55 32.1085 36.0 31.0 38.0 20.0 39.0 56 31.77575 36.0 31.0 38.0 16.0 39.0 57 31.516 35.0 31.0 38.0 16.0 39.0 58 31.336 35.0 31.0 38.0 12.0 39.0 59 31.086 35.0 31.0 38.0 8.0 39.0 60 30.9165 35.0 31.0 38.0 2.0 39.0 61 30.37225 35.0 30.0 38.0 2.0 39.0 62 29.97875 34.0 29.0 37.0 2.0 39.0 63 29.874 34.0 29.0 37.0 2.0 39.0 64 29.59225 34.0 29.0 37.0 2.0 39.0 65 28.94825 33.0 29.0 36.0 2.0 39.0 66 28.7015 33.0 28.0 36.0 2.0 39.0 67 28.44825 33.0 27.0 36.0 2.0 39.0 68 27.6705 33.0 26.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 0.0 4 1.0 5 3.0 6 4.0 7 4.0 8 3.0 9 2.0 10 4.0 11 8.0 12 10.0 13 10.0 14 16.0 15 12.0 16 21.0 17 16.0 18 9.0 19 21.0 20 27.0 21 23.0 22 41.0 23 33.0 24 25.0 25 34.0 26 54.0 27 62.0 28 70.0 29 76.0 30 96.0 31 117.0 32 149.0 33 186.0 34 243.0 35 321.0 36 484.0 37 669.0 38 701.0 39 429.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 17.28520589730554 14.667005592272497 21.50482968988307 46.54295882053889 2 17.575 26.525 35.225 20.674999999999997 3 22.3 28.7 26.625 22.375 4 22.975 32.550000000000004 22.175 22.3 5 23.525 35.8 24.775 15.9 6 19.075 36.375 23.825 20.724999999999998 7 15.625 16.725 46.075 21.575 8 18.725 24.375 29.275000000000002 27.625 9 21.125 22.475 31.424999999999997 24.975 10 20.175 37.925 22.975 18.925 11 26.150000000000002 26.275 20.775 26.8 12 21.2 24.25 28.275 26.275 13 18.5 28.575 30.625000000000004 22.3 14 20.65 27.575 29.125 22.650000000000002 15 21.099999999999998 26.85 27.85 24.2 16 20.674999999999997 27.750000000000004 29.175 22.400000000000002 17 20.625 28.975 27.825 22.575 18 20.974999999999998 26.8 28.925 23.3 19 21.05 28.4 27.675 22.875 20 21.6 28.15 27.6 22.650000000000002 21 21.4 29.025000000000002 28.125 21.45 22 21.575 28.599999999999998 27.400000000000002 22.425 23 20.75 30.4 28.325 20.525 24 21.575 28.425 27.825 22.175 25 22.075 27.125 28.1 22.7 26 21.65 28.000000000000004 27.6 22.75 27 20.825 28.475 27.425 23.275000000000002 28 21.375 27.525 28.349999999999998 22.75 29 22.675 28.249999999999996 26.974999999999998 22.1 30 21.025 28.225 28.725 22.025 31 20.8 29.099999999999998 28.349999999999998 21.75 32 21.680420105026258 29.00725181295324 26.806701675418854 22.50562640660165 33 20.225 28.4 28.15 23.225 34 20.825 27.750000000000004 27.1 24.325 35 21.475 29.525000000000002 27.1 21.9 36 22.05 30.0 26.375 21.575 37 21.275 28.799999999999997 28.050000000000004 21.875 38 21.955488872218055 28.95723930982746 27.25681420355089 21.8304576144036 39 22.5 28.425 27.025 22.05 40 21.6 28.825 26.900000000000002 22.675 41 21.075 29.525000000000002 27.200000000000003 22.2 42 22.15 28.549999999999997 27.0 22.3 43 21.099999999999998 28.525 27.775 22.6 44 22.075 28.225 27.0 22.7 45 22.041531148361273 27.220415311483613 28.49637227920941 22.241681260945708 46 22.675 27.750000000000004 27.55 22.025 47 22.175 29.375 26.55 21.9 48 21.725 27.975 28.275 22.025 49 22.45 28.025 27.35 22.175 50 21.275 27.250000000000004 28.675 22.8 51 21.85 28.125 27.250000000000004 22.775000000000002 52 21.099999999999998 28.625 27.025 23.25 53 22.825 27.425 28.15 21.6 54 22.075 27.825 27.200000000000003 22.900000000000002 55 21.224999999999998 29.425 26.85 22.5 56 21.275 28.775000000000002 29.299999999999997 20.65 57 21.555388847211805 28.782195548887223 27.556889222305575 22.1055263815954 58 21.8 26.950000000000003 27.700000000000003 23.549999999999997 59 22.75 28.799999999999997 27.325 21.125 60 22.625 28.799999999999997 25.924999999999997 22.650000000000002 61 22.650000000000002 28.299999999999997 26.5 22.55 62 21.005251312828207 29.35733933483371 27.906976744186046 21.73043260815204 63 22.650000000000002 27.800000000000004 27.425 22.125 64 23.125 27.400000000000002 26.3 23.175 65 22.025 28.375 26.825 22.775000000000002 66 20.599999999999998 29.25 28.475 21.675 67 21.6 27.474999999999998 28.4 22.525000000000002 68 22.025 28.1 28.525 21.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 2.0 18 2.5 19 2.0 20 2.0 21 2.5 22 3.0 23 3.5 24 8.0 25 12.0 26 16.5 27 27.0 28 33.0 29 37.5 30 48.0 31 54.0 32 57.0 33 84.0 34 108.0 35 136.0 36 173.5 37 183.0 38 199.0 39 239.0 40 279.5 41 296.0 42 327.5 43 362.0 44 365.0 45 364.0 46 339.0 47 315.0 48 291.5 49 241.0 50 214.0 51 196.5 52 156.5 53 134.0 54 112.5 55 78.5 56 66.0 57 58.5 58 44.5 59 38.0 60 28.0 61 17.0 62 16.0 63 14.0 64 10.5 65 8.0 66 7.0 67 5.5 68 6.0 69 8.0 70 5.5 71 2.5 72 2.0 73 2.0 74 1.0 75 0.0 76 1.0 77 3.0 78 4.0 79 2.0 80 0.5 81 1.0 82 0.5 83 0.5 84 1.0 85 0.5 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.025 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.025 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.075 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.025 58 0.0 59 0.0 60 0.0 61 0.0 62 0.025 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72292191435768 98.97500000000001 2 0.22670025188916876 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025188916876574305 0.2 9 0.0 0.0 >10 0.025188916876574305 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAAA 15 0.375 TruSeq Adapter, Index 7 (100% over 63bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGAAAA 8 0.2 TruSeq Adapter, Index 7 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.25 0.0 0.0 0.0 0.0 2 0.25 0.0 0.0 0.0 0.0 3 0.25 0.0 0.0 0.0 0.0 4 0.25 0.0 0.0 0.0 0.0 5 0.25 0.0 0.0 0.0 0.0 6 0.25 0.0 0.0 0.0 0.0 7 0.25 0.0 0.0 0.0 0.0 8 0.25 0.0 0.0 0.0 0.0 9 0.25 0.0 0.0 0.0 0.0 10 0.25 0.0 0.0 0.0 0.0 11 0.25 0.0 0.0 0.0 0.0 12 0.25 0.0 0.0 0.0 0.0 13 0.25 0.0 0.0 0.0 0.0 14 0.25 0.0 0.0 0.0 0.0 15 0.25 0.0 0.0 0.0 0.0 16 0.25 0.0 0.0 0.0 0.0 17 0.25 0.0 0.0 0.0 0.0 18 0.25 0.0 0.0 0.0 0.0 19 0.25 0.0 0.0 0.0 0.0 20 0.25 0.0 0.0 0.0 0.0 21 0.25 0.0 0.0 0.0 0.0 22 0.25 0.0 0.0 0.0 0.0 23 0.25 0.0 0.0 0.0 0.0 24 0.25 0.0 0.0 0.0 0.0 25 0.25 0.0 0.0 0.0 0.0 26 0.25 0.0 0.0 0.0 0.0 27 0.25 0.0 0.0 0.0 0.0 28 0.25 0.0 0.0 0.0 0.0 29 0.25 0.0 0.0 0.0 0.0 30 0.25 0.0 0.0 0.0 0.0 31 0.25 0.0 0.0 0.0 0.0 32 0.25 0.0 0.0 0.0 0.0 33 0.25 0.0 0.0 0.0 0.0 34 0.25 0.0 0.0 0.0 0.0 35 0.275 0.0 0.0 0.0 0.0 36 0.275 0.0 0.0 0.0 0.0 37 0.275 0.0 0.0 0.0 0.0 38 0.275 0.0 0.0 0.0 0.0 39 0.275 0.0 0.0 0.0 0.0 40 0.275 0.0 0.0 0.0 0.0 41 0.275 0.0 0.0 0.0 0.0 42 0.275 0.0 0.0 0.0 0.0 43 0.275 0.0 0.0 0.0 0.0 44 0.275 0.0 0.0 0.0 0.0 45 0.275 0.0 0.0 0.0 0.0 46 0.275 0.0 0.0 0.0 0.0 47 0.275 0.0 0.0 0.0 0.0 48 0.275 0.0 0.0 0.0 0.0 49 0.275 0.0 0.0 0.0 0.0 50 0.275 0.0 0.0 0.0 0.0 51 0.275 0.0 0.0 0.0 0.0 52 0.275 0.0 0.0 0.0 0.0 53 0.275 0.0 0.0 0.0 0.0 54 0.275 0.0 0.0 0.0 0.0 55 0.275 0.0 0.0 0.0 0.0 56 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414142 spots for SRR3207777.sra Written 414142 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra Read 414123 spots for SRR3207777.sra Written 414123 spots for SRR3207777.sra SRR ids: ['SRR3207777.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x0qrbtay SRR3207777.sra spots: 8282479 blocks: [[1, 414123], [414124, 828246], [828247, 1242369], [1242370, 1656492], [1656493, 2070615], [2070616, 2484738], [2484739, 2898861], [2898862, 3312984], [3312985, 3727107], [3727108, 4141230], [4141231, 4555353], [4555354, 4969476], [4969477, 5383599], [5383600, 5797722], [5797723, 6211845], [6211846, 6625968], [6625969, 7040091], [7040092, 7454214], [7454215, 7868337], [7868338, 8282479]] SRR3207777 file size 1739442 SRR3207777 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207777 SRR3207777_1.fastq Input file: SRR3207777_1.fastq trimmed: SRR3207777-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:19:58 2025 >> started Mon Feb 10 21:20:01 2025 >> done (3.487s) 8282479 reads processed; of these: 10753 ( 0.13%) short reads filtered out after trimming by size control 56298 ( 0.68%) empty reads filtered out after trimming by size control 8215428 (99.19%) reads available; of these: 959537 (11.68%) trimmed reads available after processing 7255891 (88.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1780 0.02% 19 3035 0.04% 20 5383 0.07% 21 1794 0.02% 22 2536 0.03% 23 4050 0.05% 24 7155 0.09% 25 12204 0.15% 26 3079 0.04% 27 3863 0.05% 28 5430 0.07% 29 8299 0.10% 30 12831 0.16% 31 3701 0.05% 32 5094 0.06% 33 5614 0.07% 34 8716 0.11% 35 13816 0.17% 36 4297 0.05% 37 5386 0.07% 38 8093 0.10% 39 13185 0.16% 40 21064 0.26% 41 5481 0.07% 42 7475 0.09% 43 11011 0.13% 44 17755 0.22% 45 29211 0.36% 46 7663 0.09% 47 10165 0.12% 48 14968 0.18% 49 24755 0.30% 50 41012 0.50% 51 10358 0.13% 52 13350 0.16% 53 19692 0.24% 54 32475 0.40% 55 54072 0.66% 56 13195 0.16% 57 17822 0.22% 58 26930 0.33% 59 46248 0.56% 60 79194 0.96% 61 18403 0.22% 62 24464 0.30% 63 35854 0.44% 64 59963 0.73% 65 97967 1.19% 66 24833 0.30% 67 54816 0.67% 68 7255891 88.32% 8215428 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=29 prefix-density=0.04 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=11 fanout-score=123.80 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=15.5 sequence=CCACCACCAACA Started job on | Feb 10 21:20:13 Started mapping on | Feb 10 21:20:14 Finished on | Feb 10 21:20:21 Mapping speed, Million of reads per hour | 4225.08 Number of input reads | 8215428 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 7588722 Uniquely mapped reads % | 92.37% Average mapped length | 66.40 Number of splices: Total | 1414825 Number of splices: Annotated (sjdb) | 1392914 Number of splices: GT/AG | 1394482 Number of splices: GC/AG | 16610 Number of splices: AT/AC | 1741 Number of splices: Non-canonical | 1992 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.76 Insertion rate per base | 0.01% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271751 % of reads mapped to multiple loci | 3.31% Number of reads mapped to too many loci | 314359 % of reads mapped to too many loci | 3.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 354955 354955 354955 N_multimapping 271751 271751 271751 N_noFeature 335761 3940207 3930859 N_ambiguous 76566 11441 11777 UnstrandedReadsAssigned:7176395 PositiveStrandReadsAssigned:3637074 NegativeStrandReadsAssigned:3646086 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207777 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207777-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,215,428 reads, 7,590,406 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52401 SRR3207777.ke.tsv 34699 SRR3207777.se.tsv 87100 total ==> SRR3207777.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 199 20.3971 Potri.005G024800.1.v4.1 1035 936 33 6.9347 Potri.004G059700.1.v4.1 961 862 8 1.82546 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 126.543 8.75179 Potri.016G087400.1.v4.1 270 171 277 318.62 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 14.4796 1.70134 Potri.012G127500.1.v4.1 977 878 600 134.415 ==> SRR3207777.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 818 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 98 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR3207777 completed mapping pipeline successfully