Starting /dee2/code/volunteer_pipeline.sh SRR3207778 current disk space = 3057116180480 free memory = 1576282164 SRR3207778 SRAfilesize fe32dccf16af884fecedf64b1dca4bbf SRR3207778.sra SRR3207778.sra file validated SRR3207778 is single end SRR3207778 is conventional basespace SRR3207778 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207778_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.4115 39.0 38.0 40.0 33.0 40.0 2 37.01925 39.0 36.0 40.0 33.0 40.0 3 37.1025 39.0 37.0 40.0 33.0 40.0 4 37.07325 39.0 37.0 40.0 33.0 40.0 5 37.10325 39.0 37.0 40.0 33.0 40.0 6 37.1235 39.0 36.0 40.0 33.0 40.0 7 37.07225 39.0 36.0 40.0 33.0 40.0 8 36.97425 39.0 36.0 40.0 33.0 40.0 9 36.931 39.0 36.0 40.0 33.0 40.0 10 36.93575 39.0 36.0 40.0 33.0 40.0 11 37.07825 39.0 36.0 40.0 33.0 40.0 12 37.06975 39.0 36.0 40.0 33.0 40.0 13 36.986 39.0 36.0 40.0 32.0 40.0 14 36.8445 38.0 36.0 40.0 31.0 40.0 15 36.959 39.0 36.0 40.0 32.0 40.0 16 37.01225 39.0 36.0 40.0 33.0 40.0 17 36.91025 38.0 36.0 40.0 31.0 40.0 18 36.65075 38.0 35.0 40.0 31.0 40.0 19 36.71225 38.0 36.0 40.0 31.0 40.0 20 36.57925 38.0 35.0 40.0 31.0 40.0 21 36.4915 38.0 35.0 40.0 31.0 40.0 22 36.44475 38.0 35.0 40.0 31.0 40.0 23 36.4115 38.0 35.0 40.0 31.0 40.0 24 36.17 38.0 35.0 40.0 30.0 40.0 25 36.111 38.0 35.0 40.0 30.0 40.0 26 35.97 38.0 35.0 39.0 30.0 40.0 27 35.7505 38.0 35.0 39.0 29.0 40.0 28 35.644 38.0 35.0 39.0 29.0 40.0 29 35.517 38.0 35.0 39.0 29.0 40.0 30 35.60275 38.0 35.0 39.0 29.0 40.0 31 35.618 38.0 35.0 39.0 29.0 40.0 32 35.4805 38.0 35.0 39.0 29.0 40.0 33 35.70725 38.0 35.0 39.0 30.0 40.0 34 35.4 38.0 34.0 39.0 29.0 40.0 35 35.36125 38.0 35.0 39.0 29.0 40.0 36 35.81625 38.0 35.0 39.0 30.0 40.0 37 35.69525 38.0 35.0 39.0 29.0 40.0 38 35.50025 38.0 35.0 39.0 29.0 40.0 39 35.34925 38.0 35.0 39.0 29.0 40.0 40 35.195 38.0 34.0 39.0 29.0 40.0 41 35.15675 38.0 34.0 39.0 29.0 40.0 42 35.01525 38.0 34.0 39.0 29.0 40.0 43 34.90325 38.0 34.0 39.0 28.0 40.0 44 34.7735 38.0 33.0 39.0 28.0 40.0 45 34.60775 38.0 33.0 39.0 28.0 40.0 46 34.539 38.0 33.0 39.0 27.0 40.0 47 34.34375 37.0 33.0 39.0 27.0 40.0 48 34.21 37.0 33.0 39.0 27.0 40.0 49 34.01675 37.0 33.0 39.0 27.0 40.0 50 33.757 36.0 33.0 39.0 26.0 40.0 51 33.64 36.0 33.0 39.0 25.0 40.0 52 33.19925 36.0 33.0 39.0 24.0 40.0 53 33.319 36.0 33.0 39.0 24.0 40.0 54 32.95325 36.0 32.0 39.0 23.0 39.0 55 32.78425 36.0 32.0 39.0 23.0 39.0 56 32.34325 36.0 32.0 39.0 19.0 39.0 57 32.13175 36.0 31.0 38.0 19.0 39.0 58 31.8955 35.0 31.0 38.0 18.0 39.0 59 31.73175 35.0 31.0 38.0 16.0 39.0 60 31.48225 35.0 31.0 38.0 13.0 39.0 61 31.027 35.0 31.0 38.0 2.0 39.0 62 30.6465 35.0 30.0 38.0 2.0 39.0 63 30.37125 35.0 30.0 38.0 2.0 39.0 64 30.16775 35.0 30.0 38.0 2.0 39.0 65 29.667 34.0 29.0 37.0 2.0 39.0 66 29.42075 34.0 29.0 37.0 2.0 39.0 67 29.13025 34.0 29.0 37.0 2.0 39.0 68 28.38175 33.0 27.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 0.0 4 1.0 5 0.0 6 1.0 7 3.0 8 3.0 9 4.0 10 5.0 11 7.0 12 9.0 13 4.0 14 11.0 15 10.0 16 10.0 17 11.0 18 14.0 19 18.0 20 21.0 21 19.0 22 24.0 23 24.0 24 39.0 25 49.0 26 53.0 27 67.0 28 75.0 29 76.0 30 99.0 31 93.0 32 130.0 33 178.0 34 262.0 35 314.0 36 491.0 37 627.0 38 730.0 39 501.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.74532592218292 15.05811015664477 17.988883274381003 41.20768064679131 2 18.325 25.525 37.425000000000004 18.725 3 22.5 28.925 25.825 22.75 4 23.575 34.925 20.05 21.45 5 24.474999999999998 35.775 22.25 17.5 6 16.925 37.375 25.025 20.674999999999997 7 16.925 16.7 45.35 21.025 8 20.225 22.425 28.249999999999996 29.099999999999998 9 20.375 22.475 31.525 25.624999999999996 10 19.375 39.300000000000004 23.474999999999998 17.849999999999998 11 25.074999999999996 27.500000000000004 21.025 26.400000000000002 12 20.7 24.325 29.4 25.575 13 18.099999999999998 29.15 31.424999999999997 21.325 14 20.05 28.1 28.925 22.925 15 21.15 27.500000000000004 28.1 23.25 16 21.475 27.950000000000003 27.975 22.6 17 22.225 27.425 28.475 21.875 18 21.075 29.225 27.35 22.35 19 21.25 28.475 27.3 22.975 20 21.875 28.449999999999996 27.725 21.95 21 21.8 28.749999999999996 27.3 22.15 22 21.875 29.925 27.05 21.15 23 22.325 28.825 27.1 21.75 24 21.275 29.549999999999997 27.725 21.45 25 20.9 29.7 27.450000000000003 21.95 26 20.275000000000002 29.349999999999998 28.849999999999998 21.525 27 21.3 28.125 28.050000000000004 22.525000000000002 28 21.825 27.650000000000002 27.975 22.55 29 21.349999999999998 28.549999999999997 28.475 21.625 30 20.95 28.15 28.349999999999998 22.55 31 21.380345086271568 28.80720180045011 27.35683920980245 22.455613903475868 32 22.58064516129032 27.506876719179797 28.00700175043761 21.905476369092273 33 20.849999999999998 28.975 26.924999999999997 23.25 34 20.7 28.075 27.650000000000002 23.575 35 22.25 28.549999999999997 27.450000000000003 21.75 36 22.025 28.125 28.225 21.625 37 21.15 28.199999999999996 28.050000000000004 22.6 38 23.330832708177045 28.032008002000502 27.206801700425103 21.43035758939735 39 21.8 28.4 27.950000000000003 21.85 40 21.675 27.950000000000003 28.199999999999996 22.175 41 21.375 30.25 26.775 21.6 42 22.775000000000002 27.55 27.700000000000003 21.975 43 22.05 27.3 28.549999999999997 22.1 44 22.900000000000002 28.349999999999998 26.950000000000003 21.8 45 22.233350025037556 27.891837756634953 28.592889334001004 21.28192288432649 46 22.25 28.199999999999996 27.55 22.0 47 22.1 28.725 28.1 21.075 48 20.95 28.549999999999997 27.925 22.575 49 21.349999999999998 28.725 26.625 23.3 50 21.475 28.65 27.175 22.7 51 22.6 27.425 28.825 21.15 52 23.325000000000003 26.974999999999998 27.474999999999998 22.225 53 22.175 27.675 27.375 22.775000000000002 54 21.725 28.825 28.050000000000004 21.4 55 21.4 27.925 28.025 22.650000000000002 56 22.375 26.75 28.199999999999996 22.675 57 22.155538884721178 28.507126781695426 27.581895473868467 21.75543885971493 58 21.0 27.800000000000004 28.7 22.5 59 21.325 27.625 27.650000000000002 23.400000000000002 60 20.325 28.15 29.525000000000002 22.0 61 22.375 27.675 27.224999999999998 22.725 62 21.905476369092273 29.00725181295324 27.181795448862218 21.905476369092273 63 22.125 28.675 26.700000000000003 22.5 64 21.95 28.65 27.900000000000002 21.5 65 23.45 27.175 27.825 21.55 66 22.775000000000002 28.199999999999996 26.875 22.15 67 21.5 28.725 28.000000000000004 21.775 68 22.3 29.75 26.075 21.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.5 18 1.0 19 1.0 20 2.5 21 3.5 22 3.0 23 4.5 24 9.5 25 13.0 26 10.0 27 17.5 28 28.0 29 28.5 30 40.0 31 51.0 32 62.5 33 84.5 34 95.0 35 125.5 36 167.0 37 178.0 38 208.0 39 252.0 40 288.0 41 310.0 42 333.0 43 364.5 44 373.0 45 374.5 46 351.0 47 326.0 48 300.0 49 247.5 50 221.0 51 183.0 52 144.0 53 143.0 54 128.5 55 88.5 56 63.0 57 55.5 58 43.5 59 39.0 60 26.0 61 13.0 62 13.0 63 11.5 64 11.0 65 6.5 66 1.0 67 3.0 68 3.5 69 2.0 70 2.0 71 2.0 72 2.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.025 32 0.025 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.025 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.15 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.025 58 0.0 59 0.0 60 0.0 61 0.0 62 0.025 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236243 spots for SRR3207778.sra Written 236243 spots for SRR3207778.sra Read 236261 spots for SRR3207778.sra Written 236261 spots for SRR3207778.sra SRR ids: ['SRR3207778.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w2q_4ef1 SRR3207778.sra spots: 4724878 blocks: [[1, 236243], [236244, 472486], [472487, 708729], [708730, 944972], [944973, 1181215], [1181216, 1417458], [1417459, 1653701], [1653702, 1889944], [1889945, 2126187], [2126188, 2362430], [2362431, 2598673], [2598674, 2834916], [2834917, 3071159], [3071160, 3307402], [3307403, 3543645], [3543646, 3779888], [3779889, 4016131], [4016132, 4252374], [4252375, 4488617], [4488618, 4724878]] SRR3207778 file size 991831 SRR3207778 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207778 SRR3207778_1.fastq Input file: SRR3207778_1.fastq trimmed: SRR3207778-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 22:01:38 2025 >> started Mon Feb 10 22:01:41 2025 >> done (2.424s) 4724878 reads processed; of these: 5584 ( 0.12%) short reads filtered out after trimming by size control 8107 ( 0.17%) empty reads filtered out after trimming by size control 4711187 (99.71%) reads available; of these: 509921 (10.82%) trimmed reads available after processing 4201266 (89.18%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 886 0.02% 19 1501 0.03% 20 2750 0.06% 21 890 0.02% 22 1299 0.03% 23 2069 0.04% 24 3391 0.07% 25 5836 0.12% 26 1466 0.03% 27 1955 0.04% 28 2694 0.06% 29 4286 0.09% 30 6478 0.14% 31 1863 0.04% 32 2511 0.05% 33 2634 0.06% 34 4420 0.09% 35 6823 0.14% 36 2095 0.04% 37 2798 0.06% 38 3983 0.08% 39 6462 0.14% 40 10620 0.23% 41 2723 0.06% 42 3738 0.08% 43 5447 0.12% 44 9122 0.19% 45 15026 0.32% 46 3948 0.08% 47 5114 0.11% 48 7805 0.17% 49 13014 0.28% 50 21576 0.46% 51 5370 0.11% 52 6954 0.15% 53 10476 0.22% 54 17198 0.37% 55 29092 0.62% 56 6935 0.15% 57 9787 0.21% 58 14602 0.31% 59 24939 0.53% 60 43180 0.92% 61 9840 0.21% 62 13164 0.28% 63 19443 0.41% 64 32884 0.70% 65 53992 1.15% 66 13722 0.29% 67 31120 0.66% 68 4201266 89.18% 4711187 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=20.71 fanout-score-rank=8 prefix-density=0.11 prefix-fanout=7.2 sequence=CACCAGCACCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=16 fanout-score=183.33 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=21.3 sequence=TTCTTCTTCTTT Started job on | Feb 10 22:01:54 Started mapping on | Feb 10 22:01:54 Finished on | Feb 10 22:02:00 Mapping speed, Million of reads per hour | 2826.71 Number of input reads | 4711187 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 4482275 Uniquely mapped reads % | 95.14% Average mapped length | 66.44 Number of splices: Total | 845383 Number of splices: Annotated (sjdb) | 832764 Number of splices: GT/AG | 833311 Number of splices: GC/AG | 9980 Number of splices: AT/AC | 996 Number of splices: Non-canonical | 1096 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 155527 % of reads mapped to multiple loci | 3.30% Number of reads mapped to too many loci | 52381 % of reads mapped to too many loci | 1.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.44% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 73385 73385 73385 N_multimapping 155527 155527 155527 N_noFeature 195944 2328556 2320280 N_ambiguous 43067 6715 7008 UnstrandedReadsAssigned:4243264 PositiveStrandReadsAssigned:2147004 NegativeStrandReadsAssigned:2154987 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207778 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207778-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,711,187 reads, 4,372,327 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR3207778.ke.tsv 34699 SRR3207778.se.tsv 87100 total ==> SRR3207778.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 149 26.5386 Potri.005G024800.1.v4.1 1035 936 19 6.93817 Potri.004G059700.1.v4.1 961 862 2 0.793031 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 78.6253 9.44931 Potri.016G087400.1.v4.1 270 171 167 333.801 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 12 2.45015 Potri.012G127500.1.v4.1 977 878 475 184.913 ==> SRR3207778.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 486 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 70 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207778 completed mapping pipeline successfully