Starting /dee2/code/volunteer_pipeline.sh SRR3207779 current disk space = 3056708583424 free memory = 1376222268 SRR3207779 SRAfilesize 810c0f28a4676436816957e3c921e88b SRR3207779.sra SRR3207779.sra file validated SRR3207779 is single end SRR3207779 is conventional basespace SRR3207779 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207779_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.515 39.0 38.0 40.0 33.0 40.0 2 37.12725 39.0 36.0 40.0 33.0 40.0 3 37.228 39.0 37.0 40.0 33.0 40.0 4 37.20825 39.0 37.0 40.0 33.0 40.0 5 37.17575 39.0 37.0 40.0 33.0 40.0 6 37.0515 39.0 36.0 40.0 33.0 40.0 7 37.086 39.0 36.0 40.0 33.0 40.0 8 37.06475 39.0 36.0 40.0 33.0 40.0 9 36.875 39.0 36.0 40.0 32.0 40.0 10 36.90175 39.0 36.0 40.0 31.0 40.0 11 37.02975 38.0 36.0 40.0 33.0 40.0 12 36.91975 38.0 36.0 40.0 32.0 40.0 13 36.867 38.0 36.0 40.0 32.0 40.0 14 36.7285 38.0 35.0 40.0 31.0 40.0 15 36.9325 38.0 36.0 40.0 31.0 40.0 16 36.896 38.0 36.0 40.0 32.0 40.0 17 36.70575 38.0 36.0 40.0 31.0 40.0 18 36.58875 38.0 35.0 40.0 31.0 40.0 19 36.5475 38.0 35.0 39.0 31.0 40.0 20 36.49475 38.0 35.0 40.0 31.0 40.0 21 36.31 38.0 35.0 39.0 30.0 40.0 22 36.38575 38.0 35.0 39.0 31.0 40.0 23 36.149 38.0 35.0 39.0 30.0 40.0 24 36.01725 38.0 35.0 39.0 30.0 40.0 25 35.84975 38.0 35.0 39.0 29.0 40.0 26 35.5865 38.0 35.0 39.0 29.0 40.0 27 35.33125 38.0 34.0 39.0 28.0 40.0 28 35.139 38.0 33.0 39.0 28.0 40.0 29 35.032 38.0 33.0 39.0 28.0 40.0 30 34.99775 38.0 33.0 39.0 28.0 40.0 31 35.1075 38.0 34.0 39.0 28.0 40.0 32 34.89275 38.0 33.0 39.0 27.0 40.0 33 34.94275 38.0 34.0 39.0 27.0 40.0 34 34.75175 38.0 33.0 39.0 27.0 40.0 35 34.70575 38.0 33.0 39.0 27.0 40.0 36 35.12975 38.0 35.0 39.0 28.0 40.0 37 34.81725 38.0 34.0 39.0 27.0 40.0 38 34.694 38.0 33.0 39.0 27.0 40.0 39 34.58925 38.0 33.0 39.0 27.0 40.0 40 34.4585 38.0 33.0 39.0 27.0 40.0 41 34.201 38.0 33.0 39.0 26.0 40.0 42 34.051 37.0 33.0 39.0 26.0 40.0 43 33.964 37.0 33.0 39.0 26.0 40.0 44 33.84925 37.0 33.0 39.0 25.0 40.0 45 33.665 37.0 33.0 39.0 25.0 40.0 46 33.3955 37.0 33.0 39.0 23.0 40.0 47 33.3615 37.0 33.0 39.0 23.0 40.0 48 33.08175 36.0 33.0 39.0 23.0 40.0 49 32.806 36.0 32.0 39.0 21.0 40.0 50 32.54575 36.0 32.0 39.0 19.0 40.0 51 32.21025 36.0 32.0 39.0 15.0 40.0 52 31.78825 36.0 31.0 39.0 14.0 39.0 53 31.823 36.0 31.0 39.0 13.0 40.0 54 31.53925 36.0 31.0 39.0 9.0 39.0 55 31.322 35.0 31.0 38.0 2.0 39.0 56 30.851 35.0 30.0 38.0 2.0 39.0 57 30.71725 35.0 30.0 38.0 2.0 39.0 58 30.455 35.0 29.0 38.0 2.0 39.0 59 30.17925 35.0 29.0 38.0 2.0 39.0 60 29.8425 35.0 29.0 38.0 2.0 39.0 61 29.21275 35.0 28.0 38.0 2.0 39.0 62 28.8915 34.0 28.0 38.0 2.0 39.0 63 28.62625 34.0 27.0 37.0 2.0 39.0 64 28.403 34.0 27.0 37.0 2.0 39.0 65 27.843 33.0 26.0 37.0 2.0 39.0 66 27.82475 33.0 26.0 37.0 2.0 39.0 67 27.35 33.0 25.0 37.0 2.0 39.0 68 26.50425 33.0 22.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 0.0 5 1.0 6 1.0 7 0.0 8 1.0 9 11.0 10 7.0 11 13.0 12 12.0 13 17.0 14 18.0 15 24.0 16 19.0 17 15.0 18 25.0 19 26.0 20 32.0 21 37.0 22 25.0 23 38.0 24 50.0 25 50.0 26 62.0 27 77.0 28 82.0 29 85.0 30 97.0 31 111.0 32 147.0 33 171.0 34 241.0 35 374.0 36 461.0 37 591.0 38 600.0 39 471.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.888217522658607 13.39375629405841 18.907351460221548 40.81067472306143 2 22.15 21.05 33.7 23.1 3 25.45 26.375 24.725 23.45 4 27.950000000000003 30.575000000000003 18.6 22.875 5 26.875 32.625 22.25 18.25 6 21.375 35.525 22.025 21.075 7 18.224999999999998 16.35 42.699999999999996 22.725 8 20.8 21.224999999999998 27.525 30.45 9 21.330332583145786 22.83070767691923 28.95723930982746 26.881720430107524 10 21.45 37.95 22.225 18.375 11 25.85 27.05 20.8 26.3 12 23.025000000000002 22.1 28.925 25.95 13 21.025 26.775 29.825000000000003 22.375 14 22.0 27.325 28.025 22.650000000000002 15 23.799999999999997 25.525 26.724999999999998 23.95 16 22.875 27.0 27.3 22.825 17 24.099999999999998 28.549999999999997 26.174999999999997 21.175 18 21.825 28.575 26.974999999999998 22.625 19 22.375 27.875 26.075 23.674999999999997 20 23.674999999999997 26.3 27.125 22.900000000000002 21 22.95 29.225 25.7 22.125 22 23.525 26.174999999999997 27.675 22.625 23 22.675 28.025 26.625 22.675 24 23.400000000000002 26.375 28.175 22.05 25 22.650000000000002 26.700000000000003 26.825 23.825 26 23.974999999999998 25.05 26.575 24.4 27 23.175 26.75 26.325 23.75 28 23.125 25.8 27.725 23.35 29 22.650000000000002 27.025 26.325 24.0 30 23.25 27.175 26.150000000000002 23.425 31 21.675 27.700000000000003 28.1 22.525000000000002 32 23.330832708177045 27.45686421605401 26.556639159789945 22.655663915978995 33 22.275 28.000000000000004 26.025 23.7 34 21.575 27.725 27.85 22.85 35 22.2 26.950000000000003 26.775 24.075 36 23.200000000000003 27.750000000000004 25.2 23.849999999999998 37 23.974999999999998 27.400000000000002 24.925 23.7 38 21.555388847211805 27.556889222305575 28.40710177544386 22.48062015503876 39 22.575 26.950000000000003 27.55 22.925 40 22.925 27.075 27.275 22.725 41 24.625 25.724999999999998 26.724999999999998 22.925 42 23.35 27.950000000000003 25.85 22.85 43 24.125 27.250000000000004 25.974999999999998 22.650000000000002 44 22.900000000000002 27.125 27.325 22.650000000000002 45 23.1807951987997 27.231807951987996 26.206551637909474 23.380845211302827 46 22.85 27.975 25.775 23.400000000000002 47 23.0 26.575 26.950000000000003 23.474999999999998 48 22.825 27.1 25.525 24.55 49 22.775000000000002 26.575 27.55 23.1 50 22.7 27.250000000000004 26.8 23.25 51 22.525000000000002 27.250000000000004 26.974999999999998 23.25 52 23.575 27.1 26.224999999999998 23.1 53 23.599999999999998 26.6 26.325 23.474999999999998 54 23.849999999999998 25.874999999999996 26.75 23.525 55 23.125 26.450000000000003 27.250000000000004 23.175 56 22.900000000000002 25.825 26.325 24.95 57 22.455613903475868 26.356589147286826 26.93173293323331 24.256064016004 58 22.400000000000002 27.525 26.85 23.225 59 23.150000000000002 27.425 27.800000000000004 21.625 60 22.325 27.075 26.325 24.275 61 23.225 26.575 26.174999999999997 24.025 62 24.55613903475869 24.93123280820205 26.581645411352838 23.93098274568642 63 24.275 27.05 25.575 23.1 64 24.125 26.724999999999998 26.950000000000003 22.2 65 23.025000000000002 27.725 25.324999999999996 23.925 66 23.799999999999997 27.250000000000004 25.650000000000002 23.3 67 22.900000000000002 27.400000000000002 26.474999999999998 23.225 68 24.15 26.924999999999997 26.474999999999998 22.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 1.0 19 0.0 20 0.5 21 2.0 22 3.0 23 3.5 24 8.0 25 12.0 26 16.5 27 20.5 28 20.0 29 24.0 30 29.5 31 31.0 32 49.5 33 73.0 34 78.0 35 98.5 36 134.0 37 149.0 38 165.5 39 202.0 40 242.5 41 263.0 42 279.5 43 295.0 44 294.0 45 309.0 46 304.5 47 285.0 48 276.0 49 249.5 50 232.0 51 223.0 52 192.0 53 170.0 54 147.0 55 106.5 56 89.0 57 88.0 58 83.5 59 80.0 60 72.5 61 62.5 62 60.0 63 44.5 64 24.0 65 19.0 66 19.0 67 20.5 68 24.5 69 27.0 70 26.0 71 21.5 72 18.0 73 15.5 74 11.5 75 10.0 76 8.0 77 8.5 78 11.0 79 6.5 80 2.5 81 3.0 82 2.0 83 1.0 84 1.0 85 2.0 86 1.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.025 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.025 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.025 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.025 58 0.0 59 0.0 60 0.0 61 0.0 62 0.025 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.65 #Duplication Level Percentage of deduplicated Percentage of total 1 97.18054837040869 93.925 2 2.2762545266425245 4.3999999999999995 3 0.46559751681324363 1.35 4 0.05173305742369374 0.2 5 0.02586652871184687 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra Read 190781 spots for SRR3207779.sra Written 190781 spots for SRR3207779.sra Read 190768 spots for SRR3207779.sra Written 190768 spots for SRR3207779.sra SRR ids: ['SRR3207779.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7zd7wve6 SRR3207779.sra spots: 3815373 blocks: [[1, 190768], [190769, 381536], [381537, 572304], [572305, 763072], [763073, 953840], [953841, 1144608], [1144609, 1335376], [1335377, 1526144], [1526145, 1716912], [1716913, 1907680], [1907681, 2098448], [2098449, 2289216], [2289217, 2479984], [2479985, 2670752], [2670753, 2861520], [2861521, 3052288], [3052289, 3243056], [3243057, 3433824], [3433825, 3624592], [3624593, 3815373]] SRR3207779 file size 800704 SRR3207779 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207779 SRR3207779_1.fastq Input file: SRR3207779_1.fastq trimmed: SRR3207779-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:08:02 2025 >> started Mon Feb 10 21:08:04 2025 >> done (1.906s) 3815373 reads processed; of these: 7430 ( 0.19%) short reads filtered out after trimming by size control 8955 ( 0.23%) empty reads filtered out after trimming by size control 3798988 (99.57%) reads available; of these: 670573 (17.65%) trimmed reads available after processing 3128415 (82.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1479 0.04% 19 2495 0.07% 20 4633 0.12% 21 1453 0.04% 22 2204 0.06% 23 3710 0.10% 24 6453 0.17% 25 11055 0.29% 26 2475 0.07% 27 3191 0.08% 28 4554 0.12% 29 7610 0.20% 30 11147 0.29% 31 2970 0.08% 32 4639 0.12% 33 4687 0.12% 34 7561 0.20% 35 12091 0.32% 36 3523 0.09% 37 4694 0.12% 38 7243 0.19% 39 11746 0.31% 40 18278 0.48% 41 4770 0.13% 42 6380 0.17% 43 9075 0.24% 44 14555 0.38% 45 24017 0.63% 46 6277 0.17% 47 8125 0.21% 48 11930 0.31% 49 19186 0.51% 50 29864 0.79% 51 7986 0.21% 52 9501 0.25% 53 14237 0.37% 54 23708 0.62% 55 36429 0.96% 56 9351 0.25% 57 12220 0.32% 58 18306 0.48% 59 29508 0.78% 60 50644 1.33% 61 12039 0.32% 62 15886 0.42% 63 21648 0.57% 64 35774 0.94% 65 56564 1.49% 66 14062 0.37% 67 28640 0.75% 68 3128415 82.35% 3798988 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=22 prefix-density=0.36 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=15 fanout-score=14.31 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=1.9 sequence=CGCATCGCCGGTAGAAGGGACGAGGCGACCGGTGCACACCTGAGGCGGACCGGCCGACCCAACCCAAAGTCCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTCCAATTACCAGACTCGAAGAGCCCGGTATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCTCTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGATGCGTCGCCAGCACGAAGGCCGTGCGATCCGTCGAGTTATCATGAATCATCAGAGCAACGGGCAGAGCCCGCGTCGACCTTTTATCTAATAAATGCGTC Started job on | Feb 10 21:08:22 Started mapping on | Feb 10 21:08:23 Finished on | Feb 10 21:08:44 Mapping speed, Million of reads per hour | 651.26 Number of input reads | 3798988 Average input read length | 65 UNIQUE READS: Uniquely mapped reads number | 2489912 Uniquely mapped reads % | 65.54% Average mapped length | 66.42 Number of splices: Total | 430672 Number of splices: Annotated (sjdb) | 422951 Number of splices: GT/AG | 424131 Number of splices: GC/AG | 5321 Number of splices: AT/AC | 536 Number of splices: Non-canonical | 684 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.69 Insertion rate per base | 0.01% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 101441 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 1164230 % of reads mapped to too many loci | 30.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.13% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1207635 1207635 1207635 N_multimapping 101441 101441 101441 N_noFeature 165034 1311278 1323824 N_ambiguous 27956 4111 4024 UnstrandedReadsAssigned:2296922 PositiveStrandReadsAssigned:1174523 NegativeStrandReadsAssigned:1162064 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207779 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207779-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,798,988 reads, 3,310,511 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR3207779.ke.tsv 34699 SRR3207779.se.tsv 87100 total ==> SRR3207779.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 94 19.5797 Potri.005G024800.1.v4.1 1035 936 6 2.56229 Potri.004G059700.1.v4.1 961 862 7 3.24596 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 34.534 4.85367 Potri.016G087400.1.v4.1 270 171 85 198.69 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 9 2.14902 Potri.012G127500.1.v4.1 977 878 95 43.2496 ==> SRR3207779.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 321 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 55 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR3207779 completed mapping pipeline successfully