Starting /dee2/code/volunteer_pipeline.sh SRR3207780 current disk space = 3057320808448 free memory = 1576614984 SRR3207780 SRAfilesize 2fabcdbdcf69ca3e6d769e5a7d77c0bb SRR3207780.sra SRR3207780.sra file validated SRR3207780 is single end SRR3207780 is conventional basespace SRR3207780 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207780_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.4585 39.0 38.0 40.0 33.0 40.0 2 37.01425 39.0 36.0 40.0 33.0 40.0 3 37.088 39.0 37.0 40.0 33.0 40.0 4 37.1355 39.0 37.0 40.0 33.0 40.0 5 37.1375 39.0 37.0 40.0 33.0 40.0 6 37.122 39.0 37.0 40.0 33.0 40.0 7 37.22325 39.0 37.0 40.0 33.0 40.0 8 37.00775 39.0 36.0 40.0 32.0 40.0 9 36.9895 39.0 36.0 40.0 32.0 40.0 10 37.0035 39.0 36.0 40.0 32.0 40.0 11 37.08925 39.0 36.0 40.0 32.0 40.0 12 37.096 39.0 36.0 40.0 33.0 40.0 13 36.92325 39.0 36.0 40.0 31.0 40.0 14 36.94275 39.0 36.0 40.0 31.0 40.0 15 36.89175 38.0 36.0 40.0 31.0 40.0 16 36.954 39.0 36.0 40.0 32.0 40.0 17 36.8265 38.0 36.0 40.0 31.0 40.0 18 36.8135 38.0 36.0 40.0 32.0 40.0 19 36.7065 38.0 36.0 40.0 31.0 40.0 20 36.58975 38.0 35.0 40.0 31.0 40.0 21 36.54 38.0 35.0 40.0 31.0 40.0 22 36.54625 38.0 35.0 40.0 31.0 40.0 23 36.50975 38.0 35.0 40.0 31.0 40.0 24 36.3255 38.0 35.0 40.0 31.0 40.0 25 36.12275 38.0 35.0 39.0 30.0 40.0 26 35.936 38.0 35.0 39.0 30.0 40.0 27 35.63575 38.0 35.0 39.0 29.0 40.0 28 35.674 38.0 35.0 39.0 29.0 40.0 29 35.4805 38.0 34.0 39.0 29.0 40.0 30 35.41175 38.0 34.0 39.0 29.0 40.0 31 35.58675 38.0 35.0 39.0 29.0 40.0 32 35.34625 38.0 34.0 39.0 28.0 40.0 33 35.559 38.0 35.0 39.0 29.0 40.0 34 35.3715 38.0 34.0 39.0 29.0 40.0 35 35.2705 38.0 34.0 39.0 29.0 40.0 36 35.81375 38.0 35.0 39.0 30.0 40.0 37 35.60775 38.0 35.0 39.0 30.0 40.0 38 35.4495 38.0 35.0 39.0 29.0 40.0 39 35.315 38.0 34.0 39.0 29.0 40.0 40 35.1215 38.0 34.0 39.0 28.0 40.0 41 35.141 38.0 35.0 39.0 29.0 40.0 42 34.921 38.0 34.0 39.0 28.0 40.0 43 34.81775 38.0 34.0 39.0 28.0 40.0 44 34.68825 38.0 33.0 39.0 27.0 40.0 45 34.526 37.0 33.0 39.0 27.0 40.0 46 34.3555 37.0 33.0 39.0 27.0 40.0 47 34.248 37.0 33.0 39.0 27.0 40.0 48 33.99375 37.0 33.0 39.0 26.0 40.0 49 33.70325 36.0 33.0 39.0 25.0 40.0 50 33.5325 36.0 33.0 39.0 25.0 40.0 51 33.36725 36.0 33.0 39.0 25.0 40.0 52 33.00825 36.0 32.0 39.0 23.0 39.0 53 32.95925 36.0 32.0 39.0 23.0 40.0 54 32.72675 36.0 32.0 39.0 23.0 39.0 55 32.40375 36.0 32.0 38.0 21.0 39.0 56 31.9455 36.0 31.0 38.0 19.0 39.0 57 31.78075 35.0 31.0 38.0 18.0 39.0 58 31.724 35.0 31.0 38.0 17.0 39.0 59 31.3375 35.0 31.0 38.0 15.0 39.0 60 31.215 35.0 31.0 38.0 7.0 39.0 61 30.6775 35.0 30.0 38.0 2.0 39.0 62 30.36275 35.0 29.0 38.0 2.0 39.0 63 30.09675 34.0 29.0 37.0 2.0 39.0 64 29.8545 34.0 29.0 37.0 2.0 39.0 65 29.363 33.0 29.0 37.0 2.0 39.0 66 29.07575 33.0 29.0 37.0 2.0 39.0 67 28.75675 33.0 28.0 36.0 2.0 39.0 68 27.8895 33.0 27.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 5.0 10 2.0 11 12.0 12 12.0 13 11.0 14 13.0 15 15.0 16 10.0 17 18.0 18 17.0 19 14.0 20 24.0 21 16.0 22 28.0 23 29.0 24 36.0 25 41.0 26 51.0 27 63.0 28 76.0 29 81.0 30 77.0 31 109.0 32 128.0 33 184.0 34 260.0 35 350.0 36 493.0 37 661.0 38 712.0 39 437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.120161902352645 14.267644826713887 16.74677460156843 43.86541866936504 2 19.55 26.125 36.55 17.775 3 22.225 29.075 25.775 22.925 4 24.375 35.225 19.55 20.849999999999998 5 24.9 35.0 22.6 17.5 6 17.825 36.55 24.775 20.849999999999998 7 16.3 16.8 44.800000000000004 22.1 8 20.25 22.55 28.749999999999996 28.449999999999996 9 19.5 23.3 30.25 26.950000000000003 10 19.8 38.975 23.825 17.4 11 24.95 28.249999999999996 20.849999999999998 25.95 12 20.349999999999998 23.375 29.275000000000002 27.0 13 17.875 27.900000000000002 33.0 21.224999999999998 14 21.025 27.925 29.15 21.9 15 20.974999999999998 26.950000000000003 28.249999999999996 23.825 16 21.375 28.749999999999996 26.775 23.1 17 21.825 28.475 26.825 22.875 18 21.425 28.925 27.125 22.525000000000002 19 22.075 27.775 28.249999999999996 21.9 20 21.85 27.975 28.175 22.0 21 22.05 27.525 27.900000000000002 22.525000000000002 22 21.55 28.749999999999996 27.275 22.425 23 21.4 28.675 28.425 21.5 24 22.8 28.249999999999996 26.450000000000003 22.5 25 22.55 29.299999999999997 26.575 21.575 26 22.325 28.599999999999998 27.0 22.075 27 20.849999999999998 27.875 28.375 22.900000000000002 28 21.875 28.725 27.400000000000002 22.0 29 21.65 28.025 27.700000000000003 22.625 30 21.925 28.725 27.925 21.425 31 22.13053263315829 28.707176794198553 27.631907976994246 21.530382595648913 32 20.885442721360683 28.58929464732366 28.414207103551774 22.11105552776388 33 22.3 27.650000000000002 27.125 22.925 34 20.775 28.975 27.425 22.825 35 20.7 29.075 29.25 20.974999999999998 36 21.65 28.499999999999996 28.125 21.725 37 22.1055263815954 26.406601650412604 27.906976744186046 23.58089522380595 38 21.555388847211805 28.257064266066518 28.657164291072768 21.530382595648913 39 22.275 28.475 27.200000000000003 22.05 40 20.7 28.775000000000002 28.199999999999996 22.325 41 22.2 27.950000000000003 28.425 21.425 42 20.875 29.225 27.224999999999998 22.675 43 22.325 28.075 28.000000000000004 21.6 44 21.6 29.299999999999997 28.1 21.0 45 21.482223335002505 27.74161241862794 27.691537305958942 23.084626940410615 46 21.775 28.249999999999996 27.224999999999998 22.75 47 21.2 29.975 27.55 21.275 48 22.025 28.875 27.425 21.675 49 22.475 29.075 26.650000000000002 21.8 50 22.900000000000002 29.049999999999997 27.500000000000004 20.549999999999997 51 21.975 30.275000000000002 27.1 20.65 52 21.025 29.75 27.975 21.25 53 22.25 28.125 27.200000000000003 22.425 54 22.925 27.775 26.8 22.5 55 21.575 27.525 28.475 22.425 56 22.230557639409852 29.132283070767688 27.38184546136534 21.255313828457115 57 22.305576394098527 27.306826706676667 27.306826706676667 23.080770192548137 58 22.280570142535634 27.28182045511378 28.93223305826457 21.50537634408602 59 21.85546386596649 28.457114278569644 28.457114278569644 21.230307576894223 60 22.75 28.125 26.724999999999998 22.400000000000002 61 22.2 28.425 27.875 21.5 62 21.780445111277817 29.182295573893473 27.056764191047762 21.980495123780948 63 21.6 28.249999999999996 27.675 22.475 64 21.775 29.125 27.3 21.8 65 22.725 28.225 27.875 21.175 66 22.875 27.425 27.525 22.175 67 22.400000000000002 27.675 27.700000000000003 22.225 68 22.725 28.475 27.325 21.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 2.5 19 4.0 20 2.5 21 1.0 22 1.0 23 2.5 24 5.5 25 7.0 26 11.5 27 25.0 28 34.0 29 39.5 30 52.5 31 60.0 32 66.0 33 93.0 34 114.0 35 121.0 36 149.0 37 170.0 38 207.5 39 258.0 40 285.0 41 299.0 42 321.0 43 346.0 44 349.0 45 367.5 46 356.0 47 326.0 48 295.5 49 237.0 50 209.0 51 187.0 52 153.5 53 142.0 54 121.0 55 86.0 56 72.0 57 59.5 58 40.5 59 34.0 60 29.5 61 21.5 62 18.0 63 15.5 64 12.5 65 9.0 66 6.0 67 4.5 68 4.5 69 6.0 70 3.5 71 1.5 72 2.0 73 1.5 74 0.5 75 0.0 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.025 32 0.05 33 0.0 34 0.0 35 0.0 36 0.0 37 0.025 38 0.025 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.15 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.025 57 0.025 58 0.025 59 0.025 60 0.0 61 0.0 62 0.025 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.075 0.0 0.0 0.0 0.0 13 0.075 0.0 0.0 0.0 0.0 14 0.075 0.0 0.0 0.0 0.0 15 0.075 0.0 0.0 0.0 0.0 16 0.075 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.075 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 39 0.1 0.0 0.0 0.0 0.0 40 0.1 0.0 0.0 0.0 0.0 41 0.1 0.0 0.0 0.0 0.0 42 0.1 0.0 0.0 0.0 0.0 43 0.1 0.0 0.0 0.0 0.0 44 0.1 0.0 0.0 0.0 0.0 45 0.1 0.0 0.0 0.0 0.0 46 0.1 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.125 0.0 0.0 0.0 0.0 52 0.125 0.0 0.0 0.0 0.0 53 0.125 0.0 0.0 0.0 0.0 54 0.125 0.0 0.0 0.0 0.0 55 0.125 0.0 0.0 0.0 0.0 56 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328102 spots for SRR3207780.sra Written 328102 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra Read 328099 spots for SRR3207780.sra Written 328099 spots for SRR3207780.sra SRR ids: ['SRR3207780.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__7j7v3nq SRR3207780.sra spots: 6561983 blocks: [[1, 328099], [328100, 656198], [656199, 984297], [984298, 1312396], [1312397, 1640495], [1640496, 1968594], [1968595, 2296693], [2296694, 2624792], [2624793, 2952891], [2952892, 3280990], [3280991, 3609089], [3609090, 3937188], [3937189, 4265287], [4265288, 4593386], [4593387, 4921485], [4921486, 5249584], [5249585, 5577683], [5577684, 5905782], [5905783, 6233881], [6233882, 6561983]] SRR3207780 file size 1377888 SRR3207780 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207780 SRR3207780_1.fastq Input file: SRR3207780_1.fastq trimmed: SRR3207780-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 22:20:18 2025 >> started Mon Feb 10 22:20:21 2025 >> done (3.071s) 6561983 reads processed; of these: 9361 ( 0.14%) short reads filtered out after trimming by size control 17266 ( 0.26%) empty reads filtered out after trimming by size control 6535356 (99.59%) reads available; of these: 739320 (11.31%) trimmed reads available after processing 5796036 (88.69%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1374 0.02% 19 2522 0.04% 20 4835 0.07% 21 1455 0.02% 22 2022 0.03% 23 3298 0.05% 24 5521 0.08% 25 9411 0.14% 26 2426 0.04% 27 3100 0.05% 28 4084 0.06% 29 6521 0.10% 30 9995 0.15% 31 2791 0.04% 32 3814 0.06% 33 4255 0.07% 34 6661 0.10% 35 10587 0.16% 36 3159 0.05% 37 4071 0.06% 38 6013 0.09% 39 9950 0.15% 40 15992 0.24% 41 4105 0.06% 42 5617 0.09% 43 8112 0.12% 44 13466 0.21% 45 22128 0.34% 46 5757 0.09% 47 7593 0.12% 48 11217 0.17% 49 19157 0.29% 50 31237 0.48% 51 7771 0.12% 52 9965 0.15% 53 14873 0.23% 54 24922 0.38% 55 41858 0.64% 56 10084 0.15% 57 13800 0.21% 58 20904 0.32% 59 35351 0.54% 60 61523 0.94% 61 14018 0.21% 62 18864 0.29% 63 27455 0.42% 64 46221 0.71% 65 76686 1.17% 66 19404 0.30% 67 43375 0.66% 68 5796036 88.69% 6535356 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=23.67 fanout-score-rank=11 prefix-density=0.10 prefix-fanout=8.0 sequence=CACCAGCACCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=13 fanout-score=199.88 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=21.5 sequence=TTCTTCTTCTTC Started job on | Feb 10 22:20:35 Started mapping on | Feb 10 22:20:36 Finished on | Feb 10 22:20:42 Mapping speed, Million of reads per hour | 3921.21 Number of input reads | 6535356 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 6125207 Uniquely mapped reads % | 93.72% Average mapped length | 66.39 Number of splices: Total | 1196532 Number of splices: Annotated (sjdb) | 1179251 Number of splices: GT/AG | 1178705 Number of splices: GC/AG | 14819 Number of splices: AT/AC | 1294 Number of splices: Non-canonical | 1714 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 223600 % of reads mapped to multiple loci | 3.42% Number of reads mapped to too many loci | 152341 % of reads mapped to too many loci | 2.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 186549 186549 186549 N_multimapping 223600 223600 223600 N_noFeature 271569 3184758 3177277 N_ambiguous 52932 8996 9256 UnstrandedReadsAssigned:5800706 PositiveStrandReadsAssigned:2931453 NegativeStrandReadsAssigned:2938674 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207780 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207780-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,535,356 reads, 6,043,736 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52401 SRR3207780.ke.tsv 34699 SRR3207780.se.tsv 87100 total ==> SRR3207780.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 154 19.562 Potri.005G024800.1.v4.1 1035 936 45 11.7193 Potri.004G059700.1.v4.1 961 862 2 0.565574 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 119.161 10.2135 Potri.016G087400.1.v4.1 270 171 221 315.038 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 11 1.60178 Potri.012G127500.1.v4.1 977 878 1132 314.281 ==> SRR3207780.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 487 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 101 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207780 completed mapping pipeline successfully