Starting /dee2/code/volunteer_pipeline.sh SRR3207781 current disk space = 3056993165312 free memory = 1148608224 SRR3207781 SRAfilesize 61dd63eba248b51fc966f09948f6e629 SRR3207781.sra SRR3207781.sra file validated SRR3207781 is single end SRR3207781 is conventional basespace SRR3207781 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207781_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.38625 39.0 38.0 40.0 33.0 40.0 2 37.0755 39.0 37.0 40.0 33.0 40.0 3 37.17925 39.0 37.0 40.0 33.0 40.0 4 37.207 39.0 37.0 40.0 33.0 40.0 5 37.14825 39.0 37.0 40.0 33.0 40.0 6 37.1375 39.0 37.0 40.0 33.0 40.0 7 37.2465 39.0 37.0 40.0 33.0 40.0 8 36.95425 39.0 36.0 40.0 32.0 40.0 9 37.07475 39.0 36.0 40.0 33.0 40.0 10 37.00725 39.0 36.0 40.0 32.0 40.0 11 37.10625 39.0 36.0 40.0 33.0 40.0 12 37.15 39.0 36.0 40.0 33.0 40.0 13 37.041 39.0 36.0 40.0 32.0 40.0 14 36.96925 38.0 36.0 40.0 31.0 40.0 15 36.9305 39.0 36.0 40.0 31.0 40.0 16 37.11725 39.0 36.0 40.0 33.0 40.0 17 36.83125 38.0 36.0 40.0 31.0 40.0 18 36.90925 38.0 36.0 40.0 32.0 40.0 19 36.77875 38.0 36.0 40.0 31.0 40.0 20 36.6395 38.0 35.0 40.0 31.0 40.0 21 36.49675 38.0 35.0 40.0 31.0 40.0 22 36.54875 38.0 35.0 40.0 31.0 40.0 23 36.45925 38.0 35.0 40.0 31.0 40.0 24 36.27275 38.0 35.0 40.0 30.0 40.0 25 36.179 38.0 35.0 40.0 30.0 40.0 26 36.06325 38.0 35.0 39.0 30.0 40.0 27 35.71075 38.0 35.0 39.0 29.0 40.0 28 35.64575 38.0 35.0 39.0 29.0 40.0 29 35.4915 38.0 34.0 39.0 29.0 40.0 30 35.3805 38.0 34.0 39.0 28.0 40.0 31 35.55 38.0 35.0 39.0 29.0 40.0 32 35.3355 38.0 34.0 39.0 29.0 40.0 33 35.59625 38.0 35.0 39.0 29.0 40.0 34 35.2665 38.0 35.0 39.0 28.0 40.0 35 35.2505 38.0 34.0 39.0 29.0 40.0 36 35.571 38.0 35.0 39.0 29.0 40.0 37 35.391 38.0 35.0 39.0 29.0 40.0 38 35.347 38.0 35.0 39.0 29.0 40.0 39 35.18675 38.0 34.0 39.0 28.0 40.0 40 35.08375 38.0 34.0 39.0 29.0 40.0 41 34.93825 38.0 34.0 39.0 28.0 40.0 42 34.78925 38.0 34.0 39.0 28.0 40.0 43 34.76525 38.0 34.0 39.0 28.0 40.0 44 34.55875 38.0 33.0 39.0 27.0 40.0 45 34.35675 37.0 33.0 39.0 27.0 40.0 46 34.25275 37.0 33.0 39.0 27.0 40.0 47 34.0745 37.0 33.0 39.0 26.0 40.0 48 33.954 37.0 33.0 39.0 26.0 40.0 49 33.67075 36.0 33.0 39.0 26.0 40.0 50 33.51225 36.0 33.0 39.0 24.0 40.0 51 33.2895 36.0 33.0 39.0 24.0 40.0 52 32.93525 36.0 32.0 39.0 23.0 39.0 53 33.01025 36.0 32.0 39.0 23.0 40.0 54 32.69825 36.0 32.0 39.0 23.0 39.0 55 32.41325 36.0 31.0 38.0 22.0 39.0 56 31.92 36.0 31.0 38.0 18.0 39.0 57 31.77075 35.0 31.0 38.0 18.0 39.0 58 31.60975 35.0 31.0 38.0 17.0 39.0 59 31.36825 35.0 31.0 38.0 13.0 39.0 60 31.081 35.0 31.0 38.0 11.0 39.0 61 30.5195 35.0 30.0 38.0 2.0 39.0 62 30.22325 34.0 29.0 37.0 2.0 39.0 63 29.988 34.0 29.0 37.0 2.0 39.0 64 29.80175 34.0 29.0 37.0 2.0 39.0 65 29.19775 33.0 29.0 36.0 2.0 39.0 66 29.02225 34.0 29.0 36.0 2.0 39.0 67 28.77625 33.0 28.0 36.0 2.0 39.0 68 27.9295 33.0 26.0 36.0 2.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 7.0 9 4.0 10 7.0 11 5.0 12 13.0 13 9.0 14 17.0 15 14.0 16 12.0 17 16.0 18 13.0 19 22.0 20 25.0 21 17.0 22 22.0 23 36.0 24 34.0 25 44.0 26 52.0 27 61.0 28 80.0 29 93.0 30 88.0 31 113.0 32 138.0 33 166.0 34 244.0 35 310.0 36 484.0 37 644.0 38 775.0 39 426.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.72803241326918 14.180805267156243 17.903266649784754 42.187895669789825 2 18.35 26.625 36.75 18.275 3 22.425 28.725 25.575 23.275000000000002 4 25.05 34.0 19.375 21.575 5 23.974999999999998 36.199999999999996 22.325 17.5 6 17.675 39.275 22.875 20.175 7 16.425 16.125 46.050000000000004 21.4 8 19.650000000000002 22.125 30.2 28.025 9 20.005001250312578 22.05551387846962 31.057764441110276 26.881720430107524 10 20.05 39.300000000000004 23.150000000000002 17.5 11 25.1 28.000000000000004 22.15 24.75 12 19.85 25.224999999999998 28.725 26.200000000000003 13 19.75 27.250000000000004 32.65 20.349999999999998 14 21.325 28.1 29.375 21.2 15 21.45 27.675 27.375 23.5 16 20.925 28.525 28.15 22.400000000000002 17 22.375 28.15 27.700000000000003 21.775 18 21.5 28.675 28.050000000000004 21.775 19 21.349999999999998 28.4 27.950000000000003 22.3 20 21.725 28.95 27.375 21.95 21 20.9 27.725 27.500000000000004 23.875 22 21.95 28.799999999999997 27.500000000000004 21.75 23 22.45 28.7 26.775 22.075 24 20.325 28.549999999999997 28.075 23.05 25 20.599999999999998 29.099999999999998 27.900000000000002 22.400000000000002 26 21.925 29.325000000000003 27.150000000000002 21.6 27 21.45 28.125 27.625 22.8 28 22.275 28.849999999999998 27.1 21.775 29 22.45 29.325000000000003 26.6 21.625 30 21.075 28.425 29.225 21.275 31 21.705426356589147 28.68217054263566 26.481620405101275 23.13078269567392 32 19.834917458729365 29.61480740370185 28.36418209104552 22.18609304652326 33 21.25 27.450000000000003 28.299999999999997 23.0 34 21.5 27.575 27.750000000000004 23.175 35 21.725 27.750000000000004 27.575 22.95 36 22.275 28.349999999999998 26.8 22.575 37 21.5 29.025000000000002 27.925 21.55 38 22.961480740370185 28.264132066033014 27.163581790895446 21.61080540270135 39 21.725 26.224999999999998 29.025000000000002 23.025000000000002 40 20.200000000000003 29.599999999999998 27.250000000000004 22.95 41 21.975 28.65 28.375 21.0 42 21.349999999999998 28.575 28.775000000000002 21.3 43 22.45 27.825 27.450000000000003 22.275 44 21.3 28.7 27.474999999999998 22.525000000000002 45 21.457185778668002 28.668002003004506 27.240861291937907 22.633950926389584 46 22.650000000000002 27.750000000000004 28.000000000000004 21.6 47 22.0 28.15 27.650000000000002 22.2 48 22.625 28.050000000000004 27.375 21.95 49 21.7 27.725 28.299999999999997 22.275 50 22.275 29.75 26.75 21.224999999999998 51 22.25 26.900000000000002 27.775 23.075000000000003 52 21.625 28.475 26.450000000000003 23.45 53 22.075 28.375 28.225 21.325 54 21.099999999999998 28.349999999999998 28.125 22.425 55 21.875 27.775 27.775 22.575 56 22.400000000000002 27.650000000000002 28.299999999999997 21.65 57 21.510755377688845 27.988994497248626 28.4392196098049 22.061030515257627 58 21.930482620655166 28.432108027006752 28.507126781695426 21.13028257064266 59 22.475 28.725 27.474999999999998 21.325 60 21.525 28.4 27.125 22.95 61 21.925 28.375 27.650000000000002 22.05 62 22.661330665332667 29.114557278639317 27.838919459729865 20.38519259629815 63 22.575 26.75 28.249999999999996 22.425 64 21.675 29.075 27.775 21.475 65 22.45 27.725 27.675 22.15 66 21.525 29.425 27.200000000000003 21.85 67 22.925 26.875 29.099999999999998 21.099999999999998 68 22.3 28.025 27.800000000000004 21.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 2.0 20 4.5 21 6.0 22 5.0 23 5.0 24 7.5 25 10.0 26 15.0 27 21.0 28 22.0 29 32.0 30 50.0 31 58.0 32 70.0 33 97.0 34 112.0 35 131.0 36 176.5 37 203.0 38 212.5 39 231.5 40 266.0 41 291.0 42 316.0 43 343.5 44 346.0 45 361.0 46 349.0 47 322.0 48 295.5 49 246.0 50 223.0 51 214.5 52 155.5 53 105.0 54 107.0 55 82.0 56 55.0 57 50.0 58 41.0 59 37.0 60 31.5 61 20.5 62 15.0 63 13.5 64 12.5 65 10.5 66 8.0 67 6.5 68 3.5 69 2.0 70 3.0 71 3.0 72 2.0 73 2.0 74 1.5 75 1.0 76 1.0 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.025 32 0.05 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.05 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.15 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.05 58 0.025 59 0.0 60 0.0 61 0.0 62 0.05 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84958636249686 99.575 2 0.12534469791927802 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0250689395838556 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGAAAAA 7 0.17500000000000002 TruSeq Adapter, Index 5 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.05 0.0 0.0 0.0 0.0 44 0.05 0.0 0.0 0.0 0.0 45 0.05 0.0 0.0 0.0 0.0 46 0.05 0.0 0.0 0.0 0.0 47 0.05 0.0 0.0 0.0 0.0 48 0.05 0.0 0.0 0.0 0.0 49 0.05 0.0 0.0 0.0 0.0 50 0.05 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCCGTC 15 0.0033454446 61.987503 48 TCTTCTG 15 0.0033454446 61.987503 53 CTTCTGC 15 0.0033454446 61.987503 54 >>END_MODULE Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra Read 358127 spots for SRR3207781.sra Written 358127 spots for SRR3207781.sra Read 358124 spots for SRR3207781.sra Written 358124 spots for SRR3207781.sra SRR ids: ['SRR3207781.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kt6k_o9g SRR3207781.sra spots: 7162483 blocks: [[1, 358124], [358125, 716248], [716249, 1074372], [1074373, 1432496], [1432497, 1790620], [1790621, 2148744], [2148745, 2506868], [2506869, 2864992], [2864993, 3223116], [3223117, 3581240], [3581241, 3939364], [3939365, 4297488], [4297489, 4655612], [4655613, 5013736], [5013737, 5371860], [5371861, 5729984], [5729985, 6088108], [6088109, 6446232], [6446233, 6804356], [6804357, 7162483]] SRR3207781 file size 1504080 SRR3207781 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207781 SRR3207781_1.fastq Input file: SRR3207781_1.fastq trimmed: SRR3207781-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 21:34:37 2025 >> started Mon Feb 10 21:34:41 2025 >> done (4.900s) 7162483 reads processed; of these: 9778 ( 0.14%) short reads filtered out after trimming by size control 18296 ( 0.26%) empty reads filtered out after trimming by size control 7134409 (99.61%) reads available; of these: 789009 (11.06%) trimmed reads available after processing 6345400 (88.94%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1511 0.02% 19 2592 0.04% 20 4468 0.06% 21 1431 0.02% 22 2160 0.03% 23 3326 0.05% 24 5738 0.08% 25 10036 0.14% 26 2465 0.03% 27 3142 0.04% 28 4402 0.06% 29 6750 0.09% 30 10288 0.14% 31 2956 0.04% 32 3903 0.05% 33 4479 0.06% 34 7204 0.10% 35 11214 0.16% 36 3383 0.05% 37 4273 0.06% 38 6530 0.09% 39 10318 0.14% 40 16860 0.24% 41 4306 0.06% 42 5916 0.08% 43 8768 0.12% 44 14324 0.20% 45 23382 0.33% 46 6194 0.09% 47 7977 0.11% 48 11842 0.17% 49 20012 0.28% 50 33258 0.47% 51 8246 0.12% 52 10704 0.15% 53 16181 0.23% 54 26554 0.37% 55 45025 0.63% 56 10911 0.15% 57 14597 0.20% 58 21761 0.31% 59 38569 0.54% 60 65671 0.92% 61 15152 0.21% 62 20207 0.28% 63 29639 0.42% 64 50179 0.70% 65 82343 1.15% 66 21038 0.29% 67 46824 0.66% 68 6345400 88.94% 7134409 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=27.78 fanout-score-rank=9 prefix-density=0.12 prefix-fanout=8.9 sequence=CACCAGCACCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=7 fanout-score=197.35 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=21.7 sequence=TTCTTCTTCTTC Started job on | Feb 10 21:34:54 Started mapping on | Feb 10 21:34:54 Finished on | Feb 10 21:35:01 Mapping speed, Million of reads per hour | 3669.12 Number of input reads | 7134409 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 6740671 Uniquely mapped reads % | 94.48% Average mapped length | 66.40 Number of splices: Total | 1283996 Number of splices: Annotated (sjdb) | 1265329 Number of splices: GT/AG | 1265091 Number of splices: GC/AG | 15630 Number of splices: AT/AC | 1426 Number of splices: Non-canonical | 1849 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 235026 % of reads mapped to multiple loci | 3.29% Number of reads mapped to too many loci | 123135 % of reads mapped to too many loci | 1.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 158712 158712 158712 N_multimapping 235026 235026 235026 N_noFeature 301390 3499774 3500295 N_ambiguous 61899 9888 10082 UnstrandedReadsAssigned:6377382 PositiveStrandReadsAssigned:3231009 NegativeStrandReadsAssigned:3230294 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207781 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207781-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,134,409 reads, 6,604,325 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR3207781.ke.tsv 34699 SRR3207781.se.tsv 87100 total ==> SRR3207781.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 152 18.0103 Potri.005G024800.1.v4.1 1035 936 18.0063 4.37422 Potri.004G059700.1.v4.1 961 862 9 2.37404 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 104.239 8.33399 Potri.016G087400.1.v4.1 270 171 210 279.239 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 31.6374 4.29733 Potri.012G127500.1.v4.1 977 878 904 234.114 ==> SRR3207781.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 641 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 114 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207781 completed mapping pipeline successfully