Starting /dee2/code/volunteer_pipeline.sh SRR3207782 current disk space = 3057614442496 free memory = 1574254288 SRR3207782 SRAfilesize e43a4f202e8c992056c5b72332319e4d SRR3207782.sra SRR3207782.sra file validated SRR3207782 is single end SRR3207782 is conventional basespace SRR3207782 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207782_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.122 38.0 37.0 40.0 33.0 40.0 2 36.84375 38.0 36.0 40.0 32.0 40.0 3 36.635 38.0 36.0 40.0 31.0 40.0 4 36.68025 38.0 36.0 40.0 31.0 40.0 5 36.786 38.0 36.0 40.0 33.0 40.0 6 36.75725 38.0 36.0 40.0 31.0 40.0 7 36.78775 38.0 36.0 40.0 32.0 40.0 8 36.6885 38.0 36.0 40.0 31.0 40.0 9 36.60275 38.0 35.0 40.0 31.0 40.0 10 36.62525 38.0 35.0 40.0 31.0 40.0 11 36.59875 38.0 35.0 40.0 31.0 40.0 12 36.397 38.0 35.0 39.0 30.0 40.0 13 36.32475 38.0 35.0 39.0 31.0 40.0 14 36.1765 38.0 35.0 39.0 30.0 40.0 15 36.2025 38.0 35.0 39.0 30.0 40.0 16 36.2835 38.0 35.0 39.0 30.0 40.0 17 36.1825 38.0 35.0 39.0 30.0 40.0 18 36.0265 38.0 35.0 39.0 29.0 40.0 19 36.0205 38.0 35.0 39.0 30.0 40.0 20 35.9305 38.0 35.0 39.0 29.0 40.0 21 35.865 38.0 35.0 39.0 29.0 40.0 22 35.614 38.0 35.0 39.0 29.0 40.0 23 35.5355 38.0 34.0 39.0 29.0 40.0 24 35.2725 38.0 33.0 39.0 28.0 40.0 25 35.10325 38.0 33.0 39.0 28.0 40.0 26 34.8095 38.0 33.0 39.0 27.0 40.0 27 34.429 38.0 33.0 39.0 26.0 40.0 28 34.4305 38.0 33.0 39.0 26.0 40.0 29 34.39475 38.0 33.0 39.0 27.0 40.0 30 34.094 37.0 33.0 39.0 25.0 40.0 31 34.2795 38.0 33.0 39.0 26.0 40.0 32 34.355 38.0 33.0 39.0 26.0 40.0 33 34.118 38.0 33.0 39.0 25.0 40.0 34 33.999 38.0 33.0 39.0 25.0 40.0 35 33.88175 37.0 33.0 39.0 25.0 40.0 36 34.082 38.0 33.0 39.0 25.0 40.0 37 33.9415 37.0 33.0 39.0 25.0 40.0 38 33.79 37.0 33.0 39.0 25.0 40.0 39 33.569 37.0 33.0 39.0 23.0 40.0 40 33.393 37.0 32.0 39.0 23.0 40.0 41 33.30475 37.0 33.0 39.0 23.0 40.0 42 32.95325 36.0 32.0 39.0 23.0 40.0 43 32.773 36.0 32.0 39.0 21.0 40.0 44 32.6585 36.0 32.0 39.0 20.0 40.0 45 32.36725 36.0 31.0 39.0 18.0 40.0 46 32.1835 36.0 31.0 39.0 16.0 40.0 47 31.91375 36.0 31.0 39.0 15.0 40.0 48 31.711 36.0 31.0 39.0 15.0 40.0 49 31.495 35.0 30.0 39.0 11.0 40.0 50 31.18225 35.0 30.0 39.0 2.0 40.0 51 30.74925 35.0 30.0 38.0 2.0 39.0 52 30.47125 35.0 29.0 38.0 2.0 39.0 53 30.373 35.0 29.0 38.0 2.0 39.0 54 30.13675 35.0 29.0 38.0 2.0 39.0 55 29.8115 35.0 29.0 38.0 2.0 39.0 56 29.473 35.0 28.0 38.0 2.0 39.0 57 29.1565 34.0 28.0 38.0 2.0 39.0 58 28.90725 34.0 27.0 38.0 2.0 39.0 59 28.65025 34.0 27.0 38.0 2.0 39.0 60 27.65125 33.0 24.0 37.0 2.0 39.0 61 27.5575 33.0 24.0 37.0 2.0 39.0 62 27.26775 33.0 23.0 36.0 2.0 39.0 63 27.1075 33.0 23.0 36.0 2.0 39.0 64 26.76975 33.0 23.0 36.0 2.0 39.0 65 26.3575 33.0 22.0 36.0 2.0 39.0 66 25.6865 33.0 16.0 36.0 2.0 39.0 67 25.5585 32.0 16.0 36.0 2.0 38.0 68 25.01075 32.0 2.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 0.0 4 0.0 5 4.0 6 3.0 7 2.0 8 4.0 9 5.0 10 11.0 11 15.0 12 32.0 13 27.0 14 24.0 15 19.0 16 31.0 17 26.0 18 33.0 19 30.0 20 35.0 21 44.0 22 37.0 23 48.0 24 47.0 25 71.0 26 71.0 27 81.0 28 99.0 29 89.0 30 124.0 31 159.0 32 154.0 33 212.0 34 255.0 35 342.0 36 425.0 37 534.0 38 561.0 39 332.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.548672566371685 14.134007585335018 17.420986093552465 41.89633375474083 2 21.475 22.875 33.45 22.2 3 25.3 27.55 24.8 22.35 4 27.275 31.574999999999996 18.275 22.875 5 27.025 33.5 20.75 18.725 6 19.35 36.75 23.0 20.9 7 17.349999999999998 16.475 42.675000000000004 23.5 8 20.674999999999997 22.35 28.775000000000002 28.199999999999996 9 21.625 21.75 29.875 26.75 10 21.675 36.95 21.9 19.475 11 26.85 26.700000000000003 19.3 27.150000000000002 12 22.475 22.400000000000002 28.225 26.900000000000002 13 21.375 27.025 29.95 21.65 14 22.75 27.1 27.250000000000004 22.900000000000002 15 21.75 27.150000000000002 27.625 23.474999999999998 16 23.3 26.450000000000003 26.75 23.5 17 23.1 26.974999999999998 27.125 22.8 18 22.7 27.3 27.500000000000004 22.5 19 24.2 26.825 26.424999999999997 22.55 20 22.825 26.275 27.125 23.775 21 21.775 27.55 27.500000000000004 23.175 22 23.724999999999998 27.425 26.025 22.825 23 23.45 27.0 27.275 22.275 24 23.200000000000003 26.775 26.825 23.200000000000003 25 22.775000000000002 27.150000000000002 24.725 25.35 26 23.175 27.200000000000003 26.875 22.75 27 23.175 26.025 26.575 24.224999999999998 28 21.925 27.075 27.975 23.025000000000002 29 23.849999999999998 27.675 25.0 23.474999999999998 30 22.2 27.800000000000004 25.374999999999996 24.625 31 22.2 27.625 26.900000000000002 23.275000000000002 32 23.95 26.875 26.575 22.6 33 22.075 26.724999999999998 27.1 24.099999999999998 34 23.35 26.924999999999997 27.025 22.7 35 23.549999999999997 28.65 25.650000000000002 22.15 36 23.799999999999997 27.474999999999998 25.674999999999997 23.05 37 22.0 26.625 27.474999999999998 23.9 38 22.975 26.474999999999998 26.724999999999998 23.825 39 23.625 26.55 25.624999999999996 24.2 40 23.974999999999998 26.375 25.4 24.25 41 23.625 26.900000000000002 26.5 22.975 42 23.65 26.974999999999998 26.075 23.3 43 23.35 25.874999999999996 27.725 23.05 44 23.075000000000003 27.325 26.924999999999997 22.675 45 23.575 27.0 26.8 22.625 46 22.975 26.950000000000003 27.224999999999998 22.85 47 23.95 27.625 25.900000000000002 22.525000000000002 48 23.325000000000003 27.6 25.074999999999996 24.0 49 23.175 26.3 26.25 24.275 50 24.2 28.15 24.6 23.05 51 23.525 28.050000000000004 25.575 22.85 52 24.474999999999998 26.650000000000002 26.1 22.775000000000002 53 24.075 26.575 26.125 23.225 54 23.125 25.8 26.400000000000002 24.675 55 22.275 27.750000000000004 27.150000000000002 22.825 56 23.95 27.35 25.974999999999998 22.725 57 22.375 27.575 27.025 23.025000000000002 58 22.25 26.0 27.825 23.925 59 24.2 26.1 27.075 22.625 60 23.599999999999998 26.575 26.375 23.45 61 25.8 26.25 25.275 22.675 62 23.925 27.725 25.025 23.325000000000003 63 23.849999999999998 24.625 27.35 24.175 64 23.45 26.125 26.5 23.925 65 22.975 28.249999999999996 25.4 23.375 66 23.25 26.474999999999998 26.950000000000003 23.325000000000003 67 23.325000000000003 27.175 25.900000000000002 23.599999999999998 68 25.124999999999996 26.825 25.6 22.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 1.0 18 1.5 19 1.0 20 1.0 21 1.5 22 2.0 23 3.0 24 6.0 25 8.0 26 7.0 27 9.5 28 13.0 29 20.0 30 31.5 31 36.0 32 48.5 33 73.0 34 85.0 35 98.0 36 130.0 37 149.0 38 163.5 39 201.5 40 241.0 41 257.0 42 264.5 43 296.5 44 321.0 45 304.5 46 297.0 47 306.0 48 301.5 49 280.0 50 263.0 51 235.0 52 185.5 53 164.0 54 144.5 55 114.5 56 104.0 57 100.0 58 81.5 59 67.0 60 60.0 61 49.5 62 46.0 63 34.0 64 28.0 65 28.0 66 22.0 67 22.5 68 20.5 69 18.0 70 15.5 71 15.0 72 17.0 73 16.5 74 15.5 75 15.0 76 16.5 77 11.5 78 5.0 79 8.0 80 7.0 81 3.0 82 3.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.975 #Duplication Level Percentage of deduplicated Percentage of total 1 97.39623614333591 94.45 2 2.217066254189224 4.3 3 0.28357824181490077 0.8250000000000001 4 0.07733952049497293 0.3 5 0.025779840164990978 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCGATTTGTCTGGTTAATTCCGTTAACGAACGAGACCTCAGCCTGCTAACTAGCTATGCGGAGGTGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.15 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10 0.15 0.0 0.0 0.0 0.0 11 0.15 0.0 0.0 0.0 0.0 12 0.15 0.0 0.0 0.0 0.0 13 0.15 0.0 0.0 0.0 0.0 14 0.15 0.0 0.0 0.0 0.0 15 0.15 0.0 0.0 0.0 0.0 16 0.15 0.0 0.0 0.0 0.0 17 0.15 0.0 0.0 0.0 0.0 18 0.175 0.0 0.0 0.0 0.0 19 0.175 0.0 0.0 0.0 0.0 20 0.175 0.0 0.0 0.0 0.0 21 0.175 0.0 0.0 0.0 0.0 22 0.175 0.0 0.0 0.0 0.0 23 0.2 0.0 0.0 0.0 0.0 24 0.2 0.0 0.0 0.0 0.0 25 0.2 0.0 0.0 0.0 0.0 26 0.2 0.0 0.0 0.0 0.0 27 0.2 0.0 0.0 0.0 0.0 28 0.2 0.0 0.0 0.0 0.0 29 0.2 0.0 0.0 0.0 0.0 30 0.2 0.0 0.0 0.0 0.0 31 0.2 0.0 0.0 0.0 0.0 32 0.2 0.0 0.0 0.0 0.0 33 0.2 0.0 0.0 0.0 0.0 34 0.2 0.0 0.0 0.0 0.0 35 0.2 0.0 0.0 0.0 0.0 36 0.2 0.0 0.0 0.0 0.0 37 0.2 0.0 0.0 0.0 0.0 38 0.2 0.0 0.0 0.0 0.0 39 0.2 0.0 0.0 0.0 0.0 40 0.2 0.0 0.0 0.0 0.0 41 0.2 0.0 0.0 0.0 0.0 42 0.2 0.0 0.0 0.0 0.0 43 0.2 0.0 0.0 0.0 0.0 44 0.2 0.0 0.0 0.0 0.0 45 0.2 0.0 0.0 0.0 0.0 46 0.2 0.0 0.0 0.0 0.0 47 0.2 0.0 0.0 0.0 0.0 48 0.2 0.0 0.0 0.0 0.0 49 0.2 0.0 0.0 0.0 0.0 50 0.2 0.0 0.0 0.0 0.0 51 0.2 0.0 0.0 0.0 0.0 52 0.2 0.0 0.0 0.0 0.0 53 0.2 0.0 0.0 0.0 0.0 54 0.2 0.0 0.0 0.0 0.0 55 0.225 0.0 0.0 0.0 0.0 56 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181551 spots for SRR3207782.sra Written 181551 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra Read 181538 spots for SRR3207782.sra Written 181538 spots for SRR3207782.sra SRR ids: ['SRR3207782.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wwm2vto3 SRR3207782.sra spots: 3630773 blocks: [[1, 181538], [181539, 363076], [363077, 544614], [544615, 726152], [726153, 907690], [907691, 1089228], [1089229, 1270766], [1270767, 1452304], [1452305, 1633842], [1633843, 1815380], [1815381, 1996918], [1996919, 2178456], [2178457, 2359994], [2359995, 2541532], [2541533, 2723070], [2723071, 2904608], [2904609, 3086146], [3086147, 3267684], [3267685, 3449222], [3449223, 3630773]] SRR3207782 file size 761920 SRR3207782 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207782 SRR3207782_1.fastq Input file: SRR3207782_1.fastq trimmed: SRR3207782-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 22:44:09 2025 >> started Mon Feb 10 22:44:11 2025 >> done (2.100s) 3630773 reads processed; of these: 9970 ( 0.27%) short reads filtered out after trimming by size control 12339 ( 0.34%) empty reads filtered out after trimming by size control 3608464 (99.39%) reads available; of these: 754963 (20.92%) trimmed reads available after processing 2853501 (79.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1928 0.05% 19 3235 0.09% 20 5795 0.16% 21 2031 0.06% 22 2882 0.08% 23 4702 0.13% 24 7869 0.22% 25 13248 0.37% 26 3309 0.09% 27 4231 0.12% 28 5551 0.15% 29 9171 0.25% 30 13630 0.38% 31 3647 0.10% 32 5495 0.15% 33 5612 0.16% 34 9235 0.26% 35 14362 0.40% 36 4327 0.12% 37 5605 0.16% 38 8794 0.24% 39 13797 0.38% 40 21117 0.59% 41 5680 0.16% 42 7347 0.20% 43 10663 0.30% 44 16995 0.47% 45 26580 0.74% 46 7182 0.20% 47 9380 0.26% 48 13391 0.37% 49 22010 0.61% 50 33033 0.92% 51 8885 0.25% 52 11209 0.31% 53 16600 0.46% 54 26458 0.73% 55 40478 1.12% 56 10860 0.30% 57 14104 0.39% 58 20299 0.56% 59 33076 0.92% 60 54143 1.50% 61 13257 0.37% 62 17565 0.49% 63 24375 0.68% 64 38193 1.06% 65 59156 1.64% 66 15122 0.42% 67 29349 0.81% 68 2853501 79.08% 3608464 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=23 prefix-density=0.34 prefix-fanout=2.0 sequence=CGCGCTTGGTTGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=25.38 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=1.0 sequence=CGCGGCTGCTTCGTTGAGCCGCGCCACGGAATCGAGAGCTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCGGGTTACGGTGCCCAACTGCGCGCTAACCTAGAACCCACAAAGGGTGTTGGTCGATTAAGACAGCAGGACGGTGGTCATGGAAGTCGAAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCCGAAAATGGATGGCGCTGAAGCGCGCGACCTATACCCGGCCGTCGGGGCAAGCGCCAGGCCCCGATGAGTAGGAGGGCGCGGCGGTCGCTGCAAAACCCGGGGCGCGAGCCCGGGCGGAGCGGCCGTCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGGGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTTAGTCGATCCTAAGAGACGGGGGAAGCCCGTCCGACAGCGCGTTCGCGCGCGAGCTT Started job on | Feb 10 22:44:26 Started mapping on | Feb 10 22:44:26 Finished on | Feb 10 22:44:33 Mapping speed, Million of reads per hour | 1855.78 Number of input reads | 3608464 Average input read length | 64 UNIQUE READS: Uniquely mapped reads number | 2414966 Uniquely mapped reads % | 66.93% Average mapped length | 65.98 Number of splices: Total | 442285 Number of splices: Annotated (sjdb) | 435416 Number of splices: GT/AG | 435739 Number of splices: GC/AG | 5320 Number of splices: AT/AC | 549 Number of splices: Non-canonical | 677 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.68 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 106096 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 1051883 % of reads mapped to too many loci | 29.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.97% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1087402 1087402 1087402 N_multimapping 106096 106096 106096 N_noFeature 141505 1265471 1274711 N_ambiguous 23755 3759 3727 UnstrandedReadsAssigned:2249706 PositiveStrandReadsAssigned:1145736 NegativeStrandReadsAssigned:1136528 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207782 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207782-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,608,464 reads, 3,150,018 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 SRR3207782.ke.tsv 34699 SRR3207782.se.tsv 87100 total ==> SRR3207782.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 75 16.3532 Potri.005G024800.1.v4.1 1035 936 10 4.47034 Potri.004G059700.1.v4.1 961 862 5 2.42705 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 28.3073 4.16471 Potri.016G087400.1.v4.1 270 171 93 227.564 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 6 1.49973 Potri.012G127500.1.v4.1 977 878 271 129.149 ==> SRR3207782.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 247 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 50 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207782 completed mapping pipeline successfully