Starting /dee2/code/volunteer_pipeline.sh SRR3207783 current disk space = 3057338757120 free memory = 1574699928 SRR3207783 SRAfilesize a2c292b83b92bb458be65da64a14e447 SRR3207783.sra SRR3207783.sra file validated SRR3207783 is single end SRR3207783 is conventional basespace SRR3207783 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207783_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.24875 39.0 36.0 40.0 33.0 40.0 2 36.0945 38.0 36.0 40.0 30.0 40.0 3 35.96725 38.0 36.0 40.0 30.0 40.0 4 35.95175 38.0 36.0 40.0 30.0 40.0 5 35.97025 38.0 35.0 40.0 30.0 40.0 6 36.17675 38.0 35.0 40.0 30.0 40.0 7 36.229 38.0 36.0 40.0 30.0 40.0 8 35.9195 38.0 35.0 40.0 29.0 40.0 9 35.96975 38.0 35.0 40.0 29.0 40.0 10 35.99675 38.0 35.0 39.0 30.0 40.0 11 36.3595 38.0 35.0 40.0 31.0 40.0 12 36.21725 38.0 35.0 39.0 30.0 40.0 13 36.0815 38.0 35.0 39.0 30.0 40.0 14 36.08925 38.0 35.0 39.0 31.0 40.0 15 35.96675 38.0 35.0 39.0 30.0 40.0 16 35.9805 38.0 35.0 39.0 30.0 40.0 17 35.8495 38.0 35.0 39.0 30.0 40.0 18 35.841 38.0 35.0 39.0 30.0 40.0 19 35.8575 38.0 35.0 39.0 29.0 40.0 20 35.7445 38.0 35.0 39.0 29.0 40.0 21 35.8285 38.0 35.0 39.0 30.0 40.0 22 35.57925 38.0 35.0 39.0 29.0 40.0 23 35.5195 38.0 35.0 39.0 29.0 40.0 24 35.40825 38.0 35.0 39.0 29.0 40.0 25 35.26525 38.0 33.0 39.0 28.0 40.0 26 35.10675 38.0 34.0 39.0 28.0 40.0 27 34.783 38.0 33.0 39.0 27.0 40.0 28 34.77525 38.0 33.0 39.0 27.0 40.0 29 34.6225 38.0 33.0 39.0 27.0 40.0 30 34.43025 37.0 33.0 39.0 27.0 40.0 31 34.6615 38.0 33.0 39.0 26.0 40.0 32 34.59325 38.0 33.0 39.0 27.0 40.0 33 34.41625 38.0 33.0 39.0 26.0 40.0 34 34.43275 38.0 33.0 39.0 26.0 40.0 35 34.42775 38.0 33.0 39.0 26.0 40.0 36 34.7755 38.0 33.0 39.0 28.0 40.0 37 34.5395 38.0 33.0 39.0 27.0 40.0 38 34.3735 37.0 33.0 39.0 27.0 40.0 39 34.10675 37.0 33.0 39.0 25.0 40.0 40 34.11075 37.0 33.0 39.0 26.0 40.0 41 33.96075 37.0 33.0 39.0 25.0 40.0 42 33.748 37.0 33.0 39.0 25.0 40.0 43 33.54925 36.0 33.0 39.0 24.0 40.0 44 33.35075 36.0 33.0 39.0 23.0 40.0 45 33.02975 36.0 32.0 39.0 23.0 40.0 46 33.12075 36.0 33.0 39.0 23.0 40.0 47 32.87325 36.0 31.0 39.0 23.0 40.0 48 32.5795 36.0 31.0 39.0 21.0 40.0 49 32.4465 36.0 31.0 39.0 21.0 39.0 50 32.29025 36.0 31.0 39.0 19.0 39.0 51 31.919 36.0 31.0 38.0 17.0 39.0 52 31.593 35.0 31.0 38.0 17.0 39.0 53 31.44575 35.0 31.0 38.0 15.0 39.0 54 31.46775 35.0 31.0 38.0 15.0 39.0 55 31.218 35.0 31.0 38.0 12.0 39.0 56 30.9215 35.0 30.0 38.0 2.0 39.0 57 30.5525 35.0 29.0 38.0 2.0 39.0 58 30.49975 35.0 30.0 38.0 2.0 39.0 59 30.1675 35.0 29.0 38.0 2.0 39.0 60 29.2655 33.0 28.0 36.0 2.0 39.0 61 29.147 34.0 28.0 37.0 2.0 39.0 62 28.859 33.0 28.0 36.0 2.0 39.0 63 28.742 33.0 28.0 36.0 2.0 39.0 64 28.52075 33.0 27.0 36.0 2.0 39.0 65 28.03475 33.0 27.0 36.0 2.0 39.0 66 27.542 33.0 26.0 36.0 2.0 38.0 67 27.1965 33.0 24.0 36.0 2.0 38.0 68 26.80125 33.0 23.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 45.0 3 1.0 4 0.0 5 2.0 6 2.0 7 2.0 8 4.0 9 4.0 10 6.0 11 3.0 12 12.0 13 16.0 14 18.0 15 17.0 16 15.0 17 19.0 18 25.0 19 29.0 20 43.0 21 25.0 22 30.0 23 49.0 24 42.0 25 57.0 26 60.0 27 77.0 28 89.0 29 88.0 30 106.0 31 115.0 32 162.0 33 211.0 34 268.0 35 382.0 36 454.0 37 592.0 38 631.0 39 299.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.44178794178794 15.566528066528065 16.735966735966738 42.25571725571726 2 19.775000000000002 26.05 35.949999999999996 18.224999999999998 3 22.025 29.2 26.55 22.225 4 23.95 33.35 20.45 22.25 5 24.85 36.75 22.475 15.925 6 18.725 36.3 24.65 20.325 7 16.7 16.975 45.65 20.674999999999997 8 19.775000000000002 23.275000000000002 28.349999999999998 28.599999999999998 9 20.175 22.125 32.0 25.7 10 19.425 38.775 24.525 17.275 11 25.275 28.499999999999996 20.125 26.1 12 20.4 25.55 29.825000000000003 24.224999999999998 13 19.1 27.875 32.1 20.925 14 21.325 28.65 29.349999999999998 20.674999999999997 15 21.475 28.449999999999996 27.375 22.7 16 21.875 28.15 27.650000000000002 22.325 17 20.775 28.599999999999998 27.775 22.85 18 20.7 28.375 28.349999999999998 22.575 19 22.375 28.050000000000004 28.725 20.849999999999998 20 21.025 27.700000000000003 28.325 22.95 21 21.45 29.075 27.700000000000003 21.775 22 22.6 28.299999999999997 27.375 21.725 23 21.0 30.95 26.900000000000002 21.15 24 21.075 29.7 27.150000000000002 22.075 25 21.775 29.049999999999997 27.450000000000003 21.725 26 22.25 28.875 26.85 22.025 27 20.925 29.725 27.625 21.725 28 21.725 28.000000000000004 28.050000000000004 22.225 29 21.65 27.700000000000003 27.650000000000002 23.0 30 20.9 27.750000000000004 28.725 22.625 31 22.1 28.000000000000004 27.400000000000002 22.5 32 21.65 29.025000000000002 27.725 21.6 33 21.224999999999998 28.449999999999996 27.775 22.55 34 21.7 29.925 27.474999999999998 20.9 35 21.099999999999998 29.45 27.325 22.125 36 21.224999999999998 28.4 28.050000000000004 22.325 37 21.625 29.349999999999998 27.224999999999998 21.8 38 21.85 28.349999999999998 28.025 21.775 39 22.325 28.625 26.625 22.425 40 20.9 30.275000000000002 27.975 20.849999999999998 41 19.7 29.825000000000003 27.825 22.650000000000002 42 21.25 28.499999999999996 28.325 21.925 43 21.349999999999998 28.475 27.775 22.400000000000002 44 22.075 27.700000000000003 28.599999999999998 21.625 45 22.525000000000002 28.975 27.224999999999998 21.275 46 22.05 27.3 27.375 23.275000000000002 47 20.150000000000002 29.349999999999998 28.7 21.8 48 21.5 27.925 28.1 22.475 49 22.0 27.875 28.799999999999997 21.325 50 21.775 28.075 27.650000000000002 22.5 51 21.85 28.125 27.55 22.475 52 21.875 28.000000000000004 27.125 23.0 53 21.375 29.099999999999998 28.15 21.375 54 21.45 28.375 28.549999999999997 21.625 55 21.325 28.199999999999996 27.950000000000003 22.525000000000002 56 21.45 29.125 27.800000000000004 21.625 57 20.674999999999997 28.549999999999997 28.15 22.625 58 21.275 28.875 27.450000000000003 22.400000000000002 59 22.025 29.125 26.724999999999998 22.125 60 21.224999999999998 28.999999999999996 28.025 21.75 61 21.475 27.525 27.900000000000002 23.1 62 22.400000000000002 28.925 27.675 21.0 63 20.8 28.599999999999998 28.449999999999996 22.15 64 21.85 27.775 28.999999999999996 21.375 65 22.1 28.025 27.500000000000004 22.375 66 20.775 28.749999999999996 27.700000000000003 22.775000000000002 67 21.175 28.65 27.400000000000002 22.775000000000002 68 22.825 28.075 28.025 21.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.5 18 1.5 19 0.0 20 1.0 21 3.0 22 4.0 23 3.5 24 9.5 25 16.0 26 17.5 27 27.0 28 35.0 29 40.5 30 48.5 31 51.0 32 62.0 33 97.5 34 122.0 35 131.5 36 171.0 37 201.0 38 219.0 39 258.0 40 306.0 41 333.0 42 339.0 43 353.0 44 361.0 45 349.0 46 326.0 47 315.0 48 285.5 49 249.0 50 242.0 51 198.5 52 135.0 53 115.0 54 109.0 55 86.0 56 69.0 57 56.0 58 35.0 59 27.0 60 26.0 61 20.0 62 15.0 63 11.0 64 6.5 65 5.5 66 5.0 67 4.0 68 3.0 69 3.0 70 1.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10 0.075 0.0 0.0 0.0 0.0 11 0.075 0.0 0.0 0.0 0.0 12 0.075 0.0 0.0 0.0 0.0 13 0.075 0.0 0.0 0.0 0.0 14 0.075 0.0 0.0 0.0 0.0 15 0.075 0.0 0.0 0.0 0.0 16 0.075 0.0 0.0 0.0 0.0 17 0.075 0.0 0.0 0.0 0.0 18 0.075 0.0 0.0 0.0 0.0 19 0.075 0.0 0.0 0.0 0.0 20 0.075 0.0 0.0 0.0 0.0 21 0.075 0.0 0.0 0.0 0.0 22 0.075 0.0 0.0 0.0 0.0 23 0.075 0.0 0.0 0.0 0.0 24 0.075 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.075 0.0 0.0 0.0 0.0 42 0.075 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.1 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626243 spots for SRR3207783.sra Written 626243 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra Read 626236 spots for SRR3207783.sra Written 626236 spots for SRR3207783.sra SRR ids: ['SRR3207783.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zejtb1hq SRR3207783.sra spots: 12524727 blocks: [[1, 626236], [626237, 1252472], [1252473, 1878708], [1878709, 2504944], [2504945, 3131180], [3131181, 3757416], [3757417, 4383652], [4383653, 5009888], [5009889, 5636124], [5636125, 6262360], [6262361, 6888596], [6888597, 7514832], [7514833, 8141068], [8141069, 8767304], [8767305, 9393540], [9393541, 10019776], [10019777, 10646012], [10646013, 11272248], [11272249, 11898484], [11898485, 12524727]] SRR3207783 file size 2633471 SRR3207783 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207783 SRR3207783_1.fastq Input file: SRR3207783_1.fastq trimmed: SRR3207783-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 22:25:28 2025 >> started Mon Feb 10 22:25:34 2025 >> done (6.232s) 12524727 reads processed; of these: 23506 ( 0.19%) short reads filtered out after trimming by size control 42330 ( 0.34%) empty reads filtered out after trimming by size control 12458891 (99.47%) reads available; of these: 1628508 (13.07%) trimmed reads available after processing 10830383 (86.93%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3469 0.03% 19 5869 0.05% 20 13846 0.11% 21 3556 0.03% 22 4759 0.04% 23 7249 0.06% 24 12432 0.10% 25 20768 0.17% 26 5720 0.05% 27 6846 0.05% 28 9328 0.07% 29 14732 0.12% 30 21861 0.18% 31 6490 0.05% 32 8541 0.07% 33 9587 0.08% 34 14694 0.12% 35 23221 0.19% 36 7161 0.06% 37 9257 0.07% 38 13778 0.11% 39 22030 0.18% 40 35070 0.28% 41 9221 0.07% 42 12339 0.10% 43 18486 0.15% 44 30388 0.24% 45 48013 0.39% 46 13075 0.10% 47 17406 0.14% 48 24698 0.20% 49 42634 0.34% 50 68238 0.55% 51 17049 0.14% 52 22244 0.18% 53 34315 0.28% 54 55168 0.44% 55 90960 0.73% 56 22873 0.18% 57 30904 0.25% 58 46054 0.37% 59 77781 0.62% 60 132888 1.07% 61 31287 0.25% 62 42881 0.34% 63 61924 0.50% 64 101568 0.82% 65 162996 1.31% 66 42578 0.34% 67 90276 0.72% 68 10830383 86.93% 12458891 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=30 prefix-density=0.04 prefix-fanout=2.0 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=12 fanout-score=166.72 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=19.8 sequence=TTCTTCTTCTTC Started job on | Feb 10 22:25:46 Started mapping on | Feb 10 22:25:46 Finished on | Feb 10 22:25:55 Mapping speed, Million of reads per hour | 4983.56 Number of input reads | 12458891 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 11876357 Uniquely mapped reads % | 95.32% Average mapped length | 66.07 Number of splices: Total | 2250057 Number of splices: Annotated (sjdb) | 2215431 Number of splices: GT/AG | 2217613 Number of splices: GC/AG | 26690 Number of splices: AT/AC | 2650 Number of splices: Non-canonical | 3104 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.74 Insertion rate per base | 0.01% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 407256 % of reads mapped to multiple loci | 3.27% Number of reads mapped to too many loci | 110442 % of reads mapped to too many loci | 0.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.51% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 175278 175278 175278 N_multimapping 407256 407256 407256 N_noFeature 537231 6160905 6176328 N_ambiguous 113475 18206 19008 UnstrandedReadsAssigned:11225651 PositiveStrandReadsAssigned:5697246 NegativeStrandReadsAssigned:5681021 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207783 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207783-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,458,891 reads, 11,496,141 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52401 SRR3207783.ke.tsv 34699 SRR3207783.se.tsv 87100 total ==> SRR3207783.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 320 22.06 Potri.005G024800.1.v4.1 1035 936 36 5.08812 Potri.004G059700.1.v4.1 961 862 13 1.99511 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 183.748 8.54719 Potri.016G087400.1.v4.1 270 171 450 348.135 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 42.5992 3.36649 Potri.012G127500.1.v4.1 977 878 1027 154.742 ==> SRR3207783.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1459 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 175 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207783 completed mapping pipeline successfully