Starting /dee2/code/volunteer_pipeline.sh SRR3207784 current disk space = 3057426796544 free memory = 1573422024 SRR3207784 SRAfilesize c32b8be8aea6df5090a96143972b0f1c SRR3207784.sra SRR3207784.sra file validated SRR3207784 is single end SRR3207784 is conventional basespace SRR3207784 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207784_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 37.0325 39.0 37.0 40.0 33.0 40.0 2 36.8365 39.0 36.0 40.0 32.0 40.0 3 36.69725 38.0 36.0 40.0 31.0 40.0 4 36.725 39.0 36.0 40.0 32.0 40.0 5 36.771 39.0 36.0 40.0 33.0 40.0 6 36.783 39.0 36.0 40.0 32.0 40.0 7 36.8555 39.0 36.0 40.0 32.0 40.0 8 36.6065 38.0 36.0 40.0 31.0 40.0 9 36.60275 38.0 36.0 40.0 31.0 40.0 10 36.61275 38.0 36.0 40.0 31.0 40.0 11 36.84375 38.0 36.0 40.0 31.0 40.0 12 36.69025 38.0 36.0 40.0 31.0 40.0 13 36.532 38.0 35.0 40.0 31.0 40.0 14 36.516 38.0 35.0 40.0 31.0 40.0 15 36.51625 38.0 35.0 39.0 31.0 40.0 16 36.53525 38.0 35.0 39.0 31.0 40.0 17 36.375 38.0 35.0 39.0 31.0 40.0 18 36.18075 38.0 35.0 39.0 30.0 40.0 19 36.36525 38.0 35.0 39.0 31.0 40.0 20 36.18875 38.0 35.0 39.0 30.0 40.0 21 36.227 38.0 35.0 39.0 31.0 40.0 22 36.01325 38.0 35.0 39.0 30.0 40.0 23 35.92925 38.0 35.0 39.0 30.0 40.0 24 35.77775 38.0 35.0 39.0 29.0 40.0 25 35.73175 38.0 35.0 39.0 29.0 40.0 26 35.39575 38.0 35.0 39.0 28.0 40.0 27 35.11275 38.0 34.0 39.0 27.0 40.0 28 35.07275 38.0 33.0 39.0 28.0 40.0 29 34.8715 38.0 33.0 39.0 27.0 40.0 30 34.769 38.0 33.0 39.0 27.0 40.0 31 35.157 38.0 34.0 39.0 28.0 40.0 32 34.99575 38.0 33.0 39.0 28.0 40.0 33 34.98775 38.0 33.0 39.0 28.0 40.0 34 34.9545 38.0 33.0 39.0 28.0 40.0 35 34.77025 38.0 33.0 39.0 27.0 40.0 36 35.12275 38.0 34.0 39.0 29.0 40.0 37 34.8445 38.0 33.0 39.0 28.0 40.0 38 34.8195 38.0 33.0 39.0 28.0 40.0 39 34.61025 38.0 33.0 39.0 27.0 40.0 40 34.42975 37.0 33.0 39.0 27.0 40.0 41 34.314 37.0 33.0 39.0 27.0 40.0 42 34.00175 37.0 33.0 39.0 26.0 40.0 43 33.9685 37.0 33.0 39.0 26.0 40.0 44 33.78075 36.0 33.0 39.0 26.0 40.0 45 33.4645 36.0 32.0 39.0 25.0 40.0 46 33.595 36.0 33.0 39.0 25.0 40.0 47 33.287 36.0 32.0 39.0 24.0 40.0 48 33.083 36.0 32.0 39.0 23.0 40.0 49 32.8945 36.0 32.0 39.0 23.0 39.0 50 32.7785 36.0 32.0 39.0 23.0 39.0 51 32.33625 36.0 31.0 39.0 19.0 39.0 52 32.02 36.0 31.0 38.0 20.0 39.0 53 31.99925 35.0 31.0 38.0 20.0 39.0 54 31.75725 35.0 31.0 38.0 18.0 39.0 55 31.54975 35.0 31.0 38.0 17.0 39.0 56 31.20325 35.0 30.0 38.0 11.0 39.0 57 30.7895 35.0 30.0 38.0 2.0 39.0 58 30.577 35.0 30.0 38.0 2.0 39.0 59 30.2475 34.0 29.0 38.0 2.0 39.0 60 29.62775 34.0 29.0 37.0 2.0 39.0 61 29.43475 34.0 29.0 37.0 2.0 39.0 62 29.252 33.0 29.0 37.0 2.0 39.0 63 28.9855 33.0 28.0 36.0 2.0 39.0 64 28.80625 33.0 28.0 36.0 2.0 39.0 65 28.4585 33.0 27.0 36.0 2.0 39.0 66 27.79975 33.0 27.0 36.0 2.0 38.0 67 27.63875 33.0 26.0 36.0 2.0 38.0 68 27.10575 33.0 23.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 0.0 4 1.0 5 2.0 6 2.0 7 1.0 8 7.0 9 8.0 10 9.0 11 6.0 12 14.0 13 11.0 14 9.0 15 13.0 16 17.0 17 14.0 18 24.0 19 25.0 20 22.0 21 20.0 22 31.0 23 36.0 24 62.0 25 46.0 26 57.0 27 93.0 28 90.0 29 92.0 30 101.0 31 118.0 32 159.0 33 206.0 34 287.0 35 360.0 36 485.0 37 602.0 38 643.0 39 315.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.07629704984741 15.310274669379451 17.47202441505595 42.141403865717194 2 18.0 25.55 36.925000000000004 19.525000000000002 3 21.675 29.975 26.400000000000002 21.95 4 24.175 34.35 20.674999999999997 20.8 5 24.075 37.4 22.275 16.25 6 18.325 37.775 24.55 19.35 7 15.299999999999999 16.950000000000003 46.175 21.575 8 19.425 23.125 28.875 28.575 9 19.5 21.975 31.8 26.724999999999998 10 18.625 39.525 24.0 17.849999999999998 11 25.374999999999996 27.250000000000004 21.75 25.624999999999996 12 21.15 24.675 29.5 24.675 13 20.175 27.650000000000002 31.125000000000004 21.05 14 20.075000000000003 27.85 30.675 21.4 15 21.75 27.950000000000003 27.1 23.200000000000003 16 21.45 28.475 28.475 21.6 17 21.725 28.249999999999996 26.950000000000003 23.075000000000003 18 21.875 27.775 27.325 23.025000000000002 19 22.05 29.725 26.825 21.4 20 21.975 29.425 27.725 20.875 21 22.275 28.775000000000002 27.725 21.224999999999998 22 21.2 28.4 28.825 21.575 23 21.425 29.225 28.65 20.7 24 21.425 27.6 27.3 23.674999999999997 25 20.974999999999998 28.925 27.55 22.55 26 21.975 28.525 27.474999999999998 22.025 27 21.5 29.049999999999997 27.400000000000002 22.05 28 22.025 29.275000000000002 27.625 21.075 29 23.35 28.075 27.125 21.45 30 21.475 28.349999999999998 27.35 22.825 31 21.175 28.65 28.15 22.025 32 21.45 28.299999999999997 28.15 22.1 33 21.7 28.349999999999998 28.225 21.725 34 21.875 28.125 28.125 21.875 35 20.75 29.099999999999998 28.4 21.75 36 22.45 28.9 27.275 21.375 37 22.425 28.175 28.325 21.075 38 22.225 29.15 28.775000000000002 19.85 39 21.725 28.675 27.525 22.075 40 22.075 28.375 27.650000000000002 21.9 41 22.95573893473368 28.00700175043761 27.85696424106027 21.180295073768445 42 22.35 28.65 27.800000000000004 21.2 43 22.075 26.924999999999997 28.4 22.6 44 21.525 28.9 28.375 21.2 45 21.125 29.349999999999998 27.625 21.9 46 23.400000000000002 27.0 28.549999999999997 21.05 47 22.175 28.575 28.299999999999997 20.95 48 21.224999999999998 28.549999999999997 29.049999999999997 21.175 49 22.35 27.150000000000002 28.325 22.175 50 21.075 29.025000000000002 27.500000000000004 22.400000000000002 51 20.375 29.4 27.200000000000003 23.025000000000002 52 20.25 28.9 28.175 22.675 53 22.175 28.000000000000004 28.249999999999996 21.575 54 22.05 28.599999999999998 28.325 21.025 55 21.6 27.650000000000002 28.725 22.025 56 21.725 28.4 28.249999999999996 21.625 57 21.7 28.4 29.15 20.75 58 22.7 27.3 29.325000000000003 20.674999999999997 59 22.35 28.15 27.125 22.375 60 21.925 28.675 28.125 21.275 61 21.55 28.325 29.075 21.05 62 21.6 29.049999999999997 28.799999999999997 20.549999999999997 63 21.825 27.525 28.525 22.125 64 21.95 28.749999999999996 28.249999999999996 21.05 65 22.975 27.1 29.299999999999997 20.625 66 22.875 28.199999999999996 27.85 21.075 67 22.35 28.475 27.200000000000003 21.975 68 22.1 28.65 27.275 21.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 1.5 22 1.0 23 3.5 24 9.0 25 12.0 26 15.0 27 22.0 28 26.0 29 36.5 30 52.5 31 58.0 32 69.5 33 96.0 34 111.0 35 134.5 36 189.0 37 220.0 38 240.0 39 268.5 40 294.0 41 311.0 42 329.0 43 330.5 44 314.0 45 324.0 46 335.5 47 337.0 48 318.0 49 252.0 50 205.0 51 189.5 52 149.0 53 124.0 54 105.0 55 73.0 56 60.0 57 49.5 58 31.0 59 23.0 60 23.0 61 15.5 62 8.0 63 7.5 64 7.0 65 6.5 66 6.0 67 5.5 68 4.0 69 3.0 70 3.0 71 2.0 72 1.0 73 0.5 74 1.5 75 3.0 76 2.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.025 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291629 spots for SRR3207784.sra Written 291629 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra Read 291619 spots for SRR3207784.sra Written 291619 spots for SRR3207784.sra SRR ids: ['SRR3207784.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_97hs2c9c SRR3207784.sra spots: 5832390 blocks: [[1, 291619], [291620, 583238], [583239, 874857], [874858, 1166476], [1166477, 1458095], [1458096, 1749714], [1749715, 2041333], [2041334, 2332952], [2332953, 2624571], [2624572, 2916190], [2916191, 3207809], [3207810, 3499428], [3499429, 3791047], [3791048, 4082666], [4082667, 4374285], [4374286, 4665904], [4665905, 4957523], [4957524, 5249142], [5249143, 5540761], [5540762, 5832390]] SRR3207784 file size 1224605 SRR3207784 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207784 SRR3207784_1.fastq Input file: SRR3207784_1.fastq trimmed: SRR3207784-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 22:30:53 2025 >> started Mon Feb 10 22:30:56 2025 >> done (2.975s) 5832390 reads processed; of these: 10853 ( 0.19%) short reads filtered out after trimming by size control 10836 ( 0.19%) empty reads filtered out after trimming by size control 5810701 (99.63%) reads available; of these: 770039 (13.25%) trimmed reads available after processing 5040662 (86.75%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1567 0.03% 19 2732 0.05% 20 4691 0.08% 21 1579 0.03% 22 2201 0.04% 23 3503 0.06% 24 5810 0.10% 25 9588 0.17% 26 2638 0.05% 27 3323 0.06% 28 4479 0.08% 29 6813 0.12% 30 10259 0.18% 31 3033 0.05% 32 4028 0.07% 33 4682 0.08% 34 6987 0.12% 35 11017 0.19% 36 3337 0.06% 37 4464 0.08% 38 6573 0.11% 39 10476 0.18% 40 16798 0.29% 41 4362 0.08% 42 6035 0.10% 43 8766 0.15% 44 14484 0.25% 45 23078 0.40% 46 6333 0.11% 47 8325 0.14% 48 11881 0.20% 49 20109 0.35% 50 32165 0.55% 51 8191 0.14% 52 10641 0.18% 53 16332 0.28% 54 26492 0.46% 55 43068 0.74% 56 10930 0.19% 57 14712 0.25% 58 21926 0.38% 59 36932 0.64% 60 62514 1.08% 61 14785 0.25% 62 20352 0.35% 63 29205 0.50% 64 48281 0.83% 65 76920 1.32% 66 20025 0.34% 67 42617 0.73% 68 5040662 86.75% 5810701 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=1.90 fanout-score-rank=42 prefix-density=0.03 prefix-fanout=1.9 sequence=CCAACCTCCTCATAATCCTTCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=10 fanout-score=213.20 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=22.7 sequence=TTCTTCTTCTTC Started job on | Feb 10 22:31:11 Started mapping on | Feb 10 22:31:11 Finished on | Feb 10 22:31:17 Mapping speed, Million of reads per hour | 3486.42 Number of input reads | 5810701 Average input read length | 66 UNIQUE READS: Uniquely mapped reads number | 5513431 Uniquely mapped reads % | 94.88% Average mapped length | 66.04 Number of splices: Total | 1048353 Number of splices: Annotated (sjdb) | 1032333 Number of splices: GT/AG | 1033035 Number of splices: GC/AG | 12571 Number of splices: AT/AC | 1203 Number of splices: Non-canonical | 1544 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 193461 % of reads mapped to multiple loci | 3.33% Number of reads mapped to too many loci | 75698 % of reads mapped to too many loci | 1.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 103809 103809 103809 N_multimapping 193461 193461 193461 N_noFeature 247990 2858253 2870351 N_ambiguous 49739 8373 8595 UnstrandedReadsAssigned:5215702 PositiveStrandReadsAssigned:2646805 NegativeStrandReadsAssigned:2634485 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207784 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207784-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,810,701 reads, 5,363,498 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR3207784.ke.tsv 34699 SRR3207784.se.tsv 87100 total ==> SRR3207784.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 151 22.2145 Potri.005G024800.1.v4.1 1035 936 22 6.63562 Potri.004G059700.1.v4.1 961 862 8 2.6201 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 88.502 8.78534 Potri.016G087400.1.v4.1 270 171 222 366.515 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 16.4346 2.77165 Potri.012G127500.1.v4.1 977 878 695 223.473 ==> SRR3207784.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 641 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 64 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207784 completed mapping pipeline successfully