Starting /dee2/code/volunteer_pipeline.sh SRR3207785 current disk space = 3057257865216 free memory = 1476296312 SRR3207785 SRAfilesize e96c6a1df4b4f487d62095d045da04a5 SRR3207785.sra SRR3207785.sra file validated SRR3207785 is single end SRR3207785 is conventional basespace SRR3207785 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207785_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.675 40.0 39.0 40.0 36.0 40.0 2 38.35975 40.0 38.0 40.0 35.0 40.0 3 38.4745 40.0 38.0 40.0 35.0 40.0 4 38.48175 40.0 38.0 40.0 35.0 40.0 5 38.4635 40.0 38.0 40.0 35.0 40.0 6 38.44225 40.0 38.0 40.0 35.0 40.0 7 38.42325 40.0 38.0 40.0 35.0 40.0 8 38.40975 40.0 38.0 40.0 35.0 40.0 9 38.33575 40.0 38.0 40.0 35.0 40.0 10 38.31775 40.0 38.0 40.0 35.0 40.0 11 38.3235 40.0 38.0 40.0 35.0 40.0 12 38.314 40.0 38.0 40.0 35.0 40.0 13 38.27225 40.0 38.0 40.0 35.0 40.0 14 38.18525 40.0 38.0 40.0 35.0 40.0 15 38.09475 39.0 38.0 40.0 35.0 40.0 16 38.07675 39.0 38.0 40.0 35.0 40.0 17 38.003 39.0 38.0 40.0 34.0 40.0 18 37.9755 39.0 38.0 40.0 34.0 40.0 19 37.89925 39.0 38.0 40.0 34.0 40.0 20 37.87675 39.0 38.0 40.0 34.0 40.0 21 37.879 39.0 38.0 40.0 34.0 40.0 22 37.77825 39.0 38.0 40.0 33.0 40.0 23 37.741 39.0 38.0 40.0 33.0 40.0 24 37.734 39.0 38.0 40.0 33.0 40.0 25 37.68425 39.0 38.0 40.0 33.0 40.0 26 37.56125 39.0 38.0 40.0 33.0 40.0 27 37.42625 39.0 38.0 40.0 33.0 40.0 28 37.431 39.0 37.0 40.0 33.0 40.0 29 37.3325 39.0 37.0 40.0 33.0 40.0 30 37.264 39.0 37.0 40.0 33.0 40.0 31 37.09675 39.0 37.0 40.0 33.0 40.0 32 36.898 39.0 37.0 40.0 32.0 40.0 33 36.826 39.0 36.0 40.0 32.0 40.0 34 36.8795 39.0 36.0 40.0 32.0 40.0 35 36.74125 39.0 36.0 40.0 31.0 40.0 36 36.80775 39.0 36.0 40.0 32.0 40.0 37 36.717 39.0 36.0 40.0 32.0 40.0 38 36.565 39.0 36.0 40.0 31.0 40.0 39 36.45625 39.0 36.0 40.0 31.0 40.0 40 36.277 39.0 36.0 40.0 31.0 40.0 41 36.29075 39.0 36.0 40.0 31.0 40.0 42 36.15575 39.0 36.0 40.0 31.0 40.0 43 36.03725 39.0 36.0 40.0 30.0 40.0 44 35.887 39.0 35.0 40.0 30.0 40.0 45 35.713 38.0 35.0 39.0 30.0 40.0 46 35.82475 38.0 36.0 39.0 30.0 40.0 47 35.60625 38.0 35.0 39.0 30.0 40.0 48 35.402 38.0 35.0 39.0 29.0 40.0 49 35.302 38.0 35.0 39.0 29.0 40.0 50 35.101 38.0 35.0 39.0 29.0 40.0 51 35.102 38.0 35.0 39.0 29.0 40.0 52 34.9955 38.0 35.0 39.0 29.0 40.0 53 34.80425 38.0 34.0 39.0 29.0 40.0 54 34.46875 37.0 34.0 39.0 28.0 40.0 55 34.39725 37.0 34.0 39.0 29.0 39.0 56 34.316 37.0 34.0 39.0 28.0 39.0 57 34.055 36.0 33.0 39.0 28.0 39.0 58 33.9235 36.0 33.0 39.0 28.0 39.0 59 33.7865 36.0 33.0 38.0 27.0 39.0 60 33.46025 36.0 33.0 38.0 27.0 39.0 61 33.232 36.0 33.0 38.0 26.0 39.0 62 32.99225 36.0 33.0 38.0 25.0 39.0 63 32.83075 36.0 33.0 38.0 25.0 39.0 64 32.60325 36.0 33.0 38.0 24.0 39.0 65 32.279 35.0 33.0 38.0 23.0 39.0 66 31.871 35.0 32.0 38.0 20.0 39.0 67 31.657 35.0 32.0 38.0 19.0 39.0 68 31.18575 35.0 31.0 37.0 17.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 2.0 6 1.0 7 1.0 8 4.0 9 3.0 10 4.0 11 4.0 12 2.0 13 12.0 14 8.0 15 10.0 16 8.0 17 11.0 18 17.0 19 13.0 20 13.0 21 16.0 22 19.0 23 9.0 24 22.0 25 22.0 26 30.0 27 31.0 28 39.0 29 39.0 30 42.0 31 63.0 32 85.0 33 101.0 34 130.0 35 216.0 36 367.0 37 614.0 38 1146.0 39 894.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.70692673168292 14.553638409602401 14.90372593148287 42.835708927231806 2 18.5678391959799 22.8643216080402 38.14070351758794 20.427135678391963 3 22.05 27.775 26.650000000000002 23.525 4 23.974999999999998 32.824999999999996 20.525 22.675 5 24.95 35.699999999999996 22.375 16.975 6 18.099999999999998 37.85 25.3 18.75 7 15.457728864432216 18.659329664832416 44.747373686843424 21.135567783891947 8 17.8 23.875 30.925000000000004 27.400000000000002 9 19.3 23.05 30.775000000000002 26.875 10 20.325 39.225 23.150000000000002 17.299999999999997 11 23.825 29.299999999999997 20.825 26.05 12 20.275000000000002 26.275 29.15 24.3 13 18.075 27.900000000000002 32.375 21.65 14 20.1 27.375 29.849999999999998 22.675 15 20.3 27.975 28.625 23.1 16 22.725 26.474999999999998 28.275 22.525000000000002 17 22.1 29.049999999999997 27.55 21.3 18 22.1 28.875 27.625 21.4 19 22.0 28.599999999999998 27.800000000000004 21.6 20 21.725 28.7 26.275 23.3 21 21.175 28.325 28.175 22.325 22 21.6 29.575000000000003 28.349999999999998 20.474999999999998 23 22.225 29.599999999999998 26.174999999999997 22.0 24 21.475 28.999999999999996 28.15 21.375 25 21.7 27.500000000000004 28.749999999999996 22.05 26 22.0 28.799999999999997 26.950000000000003 22.25 27 20.460230115057527 29.364682341170585 27.538769384692348 22.63631815907954 28 21.11055527763882 27.738869434717362 28.36418209104552 22.786393196598297 29 21.48037009252313 28.482120530132534 28.80720180045011 21.230307576894223 30 21.96098049024512 28.039019509754876 27.688844422211105 22.311155577788895 31 21.45 29.15 26.85 22.55 32 21.9 27.575 28.9 21.625 33 21.525 28.875 27.6 22.0 34 21.775 27.6 28.275 22.35 35 22.225 28.775000000000002 27.200000000000003 21.8 36 22.3 29.325000000000003 25.674999999999997 22.7 37 20.974999999999998 28.675 27.700000000000003 22.650000000000002 38 21.45 28.775000000000002 27.500000000000004 22.275 39 22.075 28.000000000000004 27.375 22.55 40 22.325 28.9 27.425 21.349999999999998 41 22.35 29.25 27.500000000000004 20.9 42 21.675 28.549999999999997 27.325 22.45 43 21.825 28.425 28.775000000000002 20.974999999999998 44 21.5 28.499999999999996 28.125 21.875 45 22.25 27.575 28.299999999999997 21.875 46 21.099999999999998 28.15 29.049999999999997 21.7 47 22.3 28.299999999999997 27.875 21.525 48 21.224999999999998 28.225 28.175 22.375 49 21.575 27.375 28.475 22.575 50 22.35 27.800000000000004 27.55 22.3 51 21.5 28.299999999999997 28.849999999999998 21.349999999999998 52 21.45 28.95 25.775 23.825 53 20.474999999999998 29.725 27.375 22.425 54 22.225 28.975 27.474999999999998 21.325 55 21.775 29.175 26.775 22.275 56 20.625 28.95 27.725 22.7 57 21.275 28.875 28.425 21.425 58 21.925 28.375 26.35 23.35 59 21.725 28.275 27.1 22.900000000000002 60 20.925 27.925 28.4 22.75 61 21.15 28.9 28.4 21.55 62 21.25 27.925 28.349999999999998 22.475 63 21.2 28.175 28.075 22.55 64 21.25 27.725 29.125 21.9 65 22.3 28.4 27.775 21.525 66 22.025 28.325 26.924999999999997 22.725 67 21.475 28.975 28.975 20.575 68 22.55 27.474999999999998 26.650000000000002 23.325000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 2.5 22 3.0 23 3.0 24 8.0 25 13.0 26 10.0 27 17.0 28 27.0 29 29.0 30 41.0 31 51.0 32 61.0 33 86.5 34 102.0 35 126.0 36 158.5 37 167.0 38 217.0 39 266.0 40 294.5 41 324.0 42 368.0 43 398.0 44 384.0 45 357.5 46 334.5 47 338.0 48 299.0 49 237.5 50 215.0 51 187.0 52 144.0 53 129.0 54 108.0 55 75.5 56 64.0 57 53.0 58 35.5 59 29.0 60 26.5 61 17.5 62 11.0 63 9.0 64 5.5 65 6.0 66 8.0 67 7.0 68 4.0 69 2.0 70 1.0 71 0.5 72 1.0 73 0.5 74 1.0 75 2.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.05 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.05 28 0.05 29 0.025 30 0.05 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.075 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.1 0.0 0.0 0.0 0.0 31 0.1 0.0 0.0 0.0 0.0 32 0.1 0.0 0.0 0.0 0.0 33 0.1 0.0 0.0 0.0 0.0 34 0.1 0.0 0.0 0.0 0.0 35 0.1 0.0 0.0 0.0 0.0 36 0.1 0.0 0.0 0.0 0.0 37 0.1 0.0 0.0 0.0 0.0 38 0.1 0.0 0.0 0.0 0.0 39 0.1 0.0 0.0 0.0 0.0 40 0.1 0.0 0.0 0.0 0.0 41 0.1 0.0 0.0 0.0 0.0 42 0.1 0.0 0.0 0.0 0.0 43 0.1 0.0 0.0 0.0 0.0 44 0.1 0.0 0.0 0.0 0.0 45 0.1 0.0 0.0 0.0 0.0 46 0.1 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391855 spots for SRR3207785.sra Written 391855 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra Read 391836 spots for SRR3207785.sra Written 391836 spots for SRR3207785.sra SRR ids: ['SRR3207785.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5supvydo SRR3207785.sra spots: 7836739 blocks: [[1, 391836], [391837, 783672], [783673, 1175508], [1175509, 1567344], [1567345, 1959180], [1959181, 2351016], [2351017, 2742852], [2742853, 3134688], [3134689, 3526524], [3526525, 3918360], [3918361, 4310196], [4310197, 4702032], [4702033, 5093868], [5093869, 5485704], [5485705, 5877540], [5877541, 6269376], [6269377, 6661212], [6661213, 7053048], [7053049, 7444884], [7444885, 7836739]] SRR3207785 file size 1653359 SRR3207785 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207785 SRR3207785_1.fastq Input file: SRR3207785_1.fastq trimmed: SRR3207785-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 22:13:02 2025 >> started Mon Feb 10 22:13:05 2025 >> done (3.360s) 7836739 reads processed; of these: 15238 ( 0.19%) short reads filtered out after trimming by size control 19902 ( 0.25%) empty reads filtered out after trimming by size control 7801599 (99.55%) reads available; of these: 487503 ( 6.25%) trimmed reads available after processing 7314096 (93.75%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1288 0.02% 19 2129 0.03% 20 3894 0.05% 21 1089 0.01% 22 1469 0.02% 23 2283 0.03% 24 3922 0.05% 25 7306 0.09% 26 1725 0.02% 27 2148 0.03% 28 2986 0.04% 29 4957 0.06% 30 8791 0.11% 31 2157 0.03% 32 2653 0.03% 33 3302 0.04% 34 5326 0.07% 35 9052 0.12% 36 2267 0.03% 37 2916 0.04% 38 4256 0.05% 39 7030 0.09% 40 12104 0.16% 41 3222 0.04% 42 3165 0.04% 43 4622 0.06% 44 7786 0.10% 45 13584 0.17% 46 3294 0.04% 47 4362 0.06% 48 6588 0.08% 49 11828 0.15% 50 21782 0.28% 51 4559 0.06% 52 5922 0.08% 53 9140 0.12% 54 15753 0.20% 55 31011 0.40% 56 6035 0.08% 57 8038 0.10% 58 12003 0.15% 59 22057 0.28% 60 46552 0.60% 61 7843 0.10% 62 10442 0.13% 63 15674 0.20% 64 28315 0.36% 65 52883 0.68% 66 9249 0.12% 67 26744 0.34% 68 7314096 93.75% 7801599 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=16.64 fanout-score-rank=14 prefix-density=0.10 prefix-fanout=6.6 sequence=CTGGTGCTGGAGCTGGAGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=7 fanout-score=166.74 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=19.8 sequence=TTCTTCTTCTTTT Started job on | Feb 10 22:13:20 Started mapping on | Feb 10 22:13:20 Finished on | Feb 10 22:13:27 Mapping speed, Million of reads per hour | 4012.25 Number of input reads | 7801599 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 7480911 Uniquely mapped reads % | 95.89% Average mapped length | 66.97 Number of splices: Total | 1465960 Number of splices: Annotated (sjdb) | 1442082 Number of splices: GT/AG | 1444573 Number of splices: GC/AG | 17831 Number of splices: AT/AC | 1676 Number of splices: Non-canonical | 1880 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.01% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 240137 % of reads mapped to multiple loci | 3.08% Number of reads mapped to too many loci | 56904 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.29% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 80551 80551 80551 N_multimapping 240137 240137 240137 N_noFeature 363815 3875682 3921553 N_ambiguous 70731 11218 12086 UnstrandedReadsAssigned:7046365 PositiveStrandReadsAssigned:3594011 NegativeStrandReadsAssigned:3547272 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207785 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207785-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,801,599 reads, 7,243,639 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR3207785.ke.tsv 34699 SRR3207785.se.tsv 87100 total ==> SRR3207785.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 157 16.9553 Potri.005G024800.1.v4.1 1035 936 19 4.20687 Potri.004G059700.1.v4.1 961 862 7 1.68296 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 118.569 8.64015 Potri.016G087400.1.v4.1 270 171 240 290.869 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 22 2.72364 Potri.012G127500.1.v4.1 977 878 600 141.625 ==> SRR3207785.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 899 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 130 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207785 completed mapping pipeline successfully