Starting /dee2/code/volunteer_pipeline.sh SRR3207786 current disk space = 3057168838656 free memory = 1508305036 SRR3207786 SRAfilesize 874bcd3be0e4321bdc378707b3e53354 SRR3207786.sra SRR3207786.sra file validated SRR3207786 is single end SRR3207786 is conventional basespace SRR3207786 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207786_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.6405 40.0 39.0 40.0 36.0 40.0 2 38.313 40.0 38.0 40.0 35.0 40.0 3 38.46075 40.0 38.0 40.0 35.0 40.0 4 38.40725 40.0 38.0 40.0 35.0 40.0 5 38.42025 40.0 38.0 40.0 35.0 40.0 6 38.4275 40.0 38.0 40.0 35.0 40.0 7 38.40475 40.0 38.0 40.0 35.0 40.0 8 38.37975 40.0 38.0 40.0 35.0 40.0 9 38.2665 40.0 38.0 40.0 35.0 40.0 10 38.24625 40.0 38.0 40.0 35.0 40.0 11 38.29575 40.0 38.0 40.0 35.0 40.0 12 38.19925 40.0 38.0 40.0 35.0 40.0 13 38.1475 40.0 38.0 40.0 35.0 40.0 14 38.1635 40.0 38.0 40.0 35.0 40.0 15 38.0955 40.0 38.0 40.0 35.0 40.0 16 38.11225 40.0 38.0 40.0 35.0 40.0 17 38.10425 39.0 38.0 40.0 35.0 40.0 18 38.024 39.0 38.0 40.0 35.0 40.0 19 37.996 39.0 38.0 40.0 34.0 40.0 20 37.86125 39.0 38.0 40.0 34.0 40.0 21 37.93725 39.0 38.0 40.0 35.0 40.0 22 37.778 39.0 38.0 40.0 34.0 40.0 23 37.75975 39.0 38.0 40.0 33.0 40.0 24 37.77 39.0 38.0 40.0 33.0 40.0 25 37.673 39.0 38.0 40.0 33.0 40.0 26 37.50125 39.0 38.0 40.0 33.0 40.0 27 37.451 39.0 38.0 40.0 33.0 40.0 28 37.315 39.0 38.0 40.0 33.0 40.0 29 37.2175 39.0 37.0 40.0 33.0 40.0 30 37.11925 39.0 37.0 40.0 33.0 40.0 31 37.00425 39.0 37.0 40.0 33.0 40.0 32 36.83325 39.0 36.0 40.0 32.0 40.0 33 36.88275 39.0 36.0 40.0 32.0 40.0 34 36.796 39.0 36.0 40.0 32.0 40.0 35 36.724 39.0 36.0 40.0 31.0 40.0 36 36.813 39.0 36.0 40.0 32.0 40.0 37 36.6495 39.0 36.0 40.0 31.0 40.0 38 36.625 39.0 36.0 40.0 31.0 40.0 39 36.41125 39.0 36.0 40.0 31.0 40.0 40 36.2465 39.0 36.0 40.0 31.0 40.0 41 36.2085 39.0 36.0 40.0 31.0 40.0 42 36.13525 39.0 36.0 40.0 31.0 40.0 43 35.96725 39.0 36.0 40.0 30.0 40.0 44 35.9905 38.0 35.0 40.0 30.0 40.0 45 35.842 38.0 35.0 39.0 30.0 40.0 46 35.8275 38.0 36.0 39.0 31.0 40.0 47 35.6525 38.0 35.0 39.0 30.0 40.0 48 35.5835 38.0 35.0 39.0 30.0 40.0 49 35.442 38.0 35.0 39.0 30.0 40.0 50 35.2465 38.0 35.0 39.0 30.0 40.0 51 35.116 38.0 35.0 39.0 29.0 40.0 52 34.86325 38.0 35.0 39.0 29.0 40.0 53 34.706 38.0 34.0 39.0 29.0 40.0 54 34.5205 37.0 34.0 39.0 29.0 40.0 55 34.304 37.0 34.0 39.0 28.0 39.0 56 34.2105 37.0 34.0 39.0 29.0 39.0 57 34.04875 36.0 33.0 39.0 28.0 39.0 58 33.775 36.0 33.0 38.0 27.0 39.0 59 33.7255 36.0 33.0 38.0 27.0 39.0 60 33.44775 36.0 33.0 38.0 26.0 39.0 61 33.236 36.0 33.0 38.0 25.0 39.0 62 33.0435 36.0 33.0 38.0 25.0 39.0 63 32.7875 36.0 33.0 38.0 24.0 39.0 64 32.52775 36.0 33.0 38.0 23.0 39.0 65 32.332 35.0 33.0 38.0 23.0 39.0 66 31.98825 35.0 32.0 38.0 21.0 39.0 67 31.745 35.0 32.0 37.0 20.0 39.0 68 31.2845 35.0 31.0 37.0 18.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 1.0 5 0.0 6 0.0 7 2.0 8 1.0 9 5.0 10 5.0 11 10.0 12 12.0 13 3.0 14 7.0 15 10.0 16 11.0 17 14.0 18 8.0 19 12.0 20 10.0 21 11.0 22 13.0 23 25.0 24 17.0 25 23.0 26 24.0 27 28.0 28 30.0 29 45.0 30 64.0 31 43.0 32 72.0 33 107.0 34 155.0 35 211.0 36 343.0 37 631.0 38 1138.0 39 904.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.875 16.650000000000002 14.499999999999998 39.975 2 18.754707506904346 25.608837559628423 37.81069545568666 17.82575947778057 3 22.875 28.15 26.375 22.6 4 22.825 34.525 20.5 22.15 5 24.525 35.85 22.05 17.575 6 18.525 39.074999999999996 24.125 18.275 7 15.907953976988495 17.38369184592296 44.94747373686843 21.76088044022011 8 19.075 23.075000000000003 30.025000000000002 27.825 9 20.5 21.95 31.75 25.8 10 19.625 40.025 24.0 16.35 11 25.575 28.15 21.325 24.95 12 20.974999999999998 25.674999999999997 28.9 24.45 13 19.75 28.475 30.599999999999998 21.175 14 20.45 27.800000000000004 29.799999999999997 21.95 15 21.6 27.05 29.9 21.45 16 23.075000000000003 27.85 27.0 22.075 17 22.400000000000002 28.4 26.924999999999997 22.275 18 21.575 28.4 28.199999999999996 21.825 19 22.6 28.65 26.85 21.9 20 21.224999999999998 29.349999999999998 28.15 21.275 21 22.25 28.175 27.750000000000004 21.825 22 21.3 29.675 26.700000000000003 22.325 23 20.4 29.099999999999998 28.925 21.575 24 22.5 28.125 27.450000000000003 21.925 25 22.5 29.549999999999997 26.3 21.65 26 21.3 30.049999999999997 27.05 21.6 27 20.935467733866933 29.214607303651825 27.43871935967984 22.411205602801402 28 22.161080540270135 27.938969484742373 27.063531765882942 22.836418209104554 29 21.875 28.825 27.55 21.75 30 21.160580290145074 28.61430715357679 28.46423211605803 21.76088044022011 31 21.425 28.050000000000004 28.1 22.425 32 21.75 29.075 27.375 21.8 33 22.575 27.35 27.075 23.0 34 21.625 28.599999999999998 26.724999999999998 23.05 35 20.4 29.099999999999998 28.625 21.875 36 21.4 29.475 27.375 21.75 37 22.025 27.400000000000002 28.575 22.0 38 21.975 27.900000000000002 28.025 22.1 39 21.349999999999998 28.225 28.449999999999996 21.975 40 21.0 28.325 27.900000000000002 22.775000000000002 41 22.475 28.925 27.175 21.425 42 21.725 28.4 27.575 22.3 43 20.825 28.675 27.900000000000002 22.6 44 22.15 28.249999999999996 27.925 21.675 45 21.8 27.525 28.749999999999996 21.925 46 21.15 29.099999999999998 27.150000000000002 22.6 47 20.7 28.050000000000004 29.299999999999997 21.95 48 20.225 29.375 27.950000000000003 22.45 49 20.525 27.650000000000002 28.775000000000002 23.05 50 21.349999999999998 28.999999999999996 28.275 21.375 51 21.85 29.275000000000002 27.775 21.099999999999998 52 22.45 28.275 27.500000000000004 21.775 53 21.875 27.875 28.95 21.3 54 22.275 28.599999999999998 27.525 21.6 55 21.9 27.900000000000002 28.15 22.05 56 22.875 27.05 28.199999999999996 21.875 57 21.775 26.275 29.849999999999998 22.1 58 22.400000000000002 27.85 27.975 21.775 59 21.65 29.2 27.450000000000003 21.7 60 20.674999999999997 28.349999999999998 29.075 21.9 61 20.724999999999998 28.425 28.575 22.275 62 22.375 28.375 28.175 21.075 63 22.1 29.275000000000002 27.750000000000004 20.875 64 21.925 28.775000000000002 26.5 22.8 65 20.974999999999998 28.349999999999998 28.4 22.275 66 21.625 28.299999999999997 28.449999999999996 21.625 67 21.8 27.85 28.349999999999998 22.0 68 21.525 28.725 27.625 22.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 5.0 22 7.0 23 6.0 24 11.0 25 17.0 26 16.0 27 18.5 28 22.0 29 35.0 30 57.5 31 67.0 32 79.0 33 108.5 34 126.0 35 123.5 36 144.5 37 168.0 38 194.5 39 245.5 40 290.0 41 310.0 42 339.0 43 371.5 44 375.0 45 357.5 46 330.5 47 321.0 48 306.0 49 261.5 50 232.0 51 201.0 52 148.5 53 127.0 54 106.5 55 75.5 56 65.0 57 49.0 58 28.0 59 23.0 60 22.5 61 19.0 62 16.0 63 12.0 64 6.5 65 4.5 66 4.0 67 3.0 68 3.5 69 5.0 70 2.5 71 1.0 72 2.0 73 3.5 74 3.0 75 1.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.05 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.05 28 0.05 29 0.0 30 0.05 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84958636249686 99.575 2 0.1002757583354224 0.2 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0250689395838556 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGAAAAA 6 0.15 TruSeq Adapter, Index 3 (100% over 63bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433177 spots for SRR3207786.sra Written 433177 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra Read 433169 spots for SRR3207786.sra Written 433169 spots for SRR3207786.sra SRR ids: ['SRR3207786.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_11xkygci SRR3207786.sra spots: 8663388 blocks: [[1, 433169], [433170, 866338], [866339, 1299507], [1299508, 1732676], [1732677, 2165845], [2165846, 2599014], [2599015, 3032183], [3032184, 3465352], [3465353, 3898521], [3898522, 4331690], [4331691, 4764859], [4764860, 5198028], [5198029, 5631197], [5631198, 6064366], [6064367, 6497535], [6497536, 6930704], [6930705, 7363873], [7363874, 7797042], [7797043, 8230211], [8230212, 8663388]] SRR3207786 file size 1827876 SRR3207786 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207786 SRR3207786_1.fastq Input file: SRR3207786_1.fastq trimmed: SRR3207786-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 22:09:07 2025 >> started Mon Feb 10 22:09:11 2025 >> done (4.266s) 8663388 reads processed; of these: 17115 ( 0.20%) short reads filtered out after trimming by size control 36322 ( 0.42%) empty reads filtered out after trimming by size control 8609951 (99.38%) reads available; of these: 551541 ( 6.41%) trimmed reads available after processing 8058410 (93.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1459 0.02% 19 2363 0.03% 20 4313 0.05% 21 1256 0.01% 22 1785 0.02% 23 2628 0.03% 24 4376 0.05% 25 8441 0.10% 26 2043 0.02% 27 2531 0.03% 28 3497 0.04% 29 5588 0.06% 30 9944 0.12% 31 2385 0.03% 32 3096 0.04% 33 3700 0.04% 34 5977 0.07% 35 10271 0.12% 36 2440 0.03% 37 3267 0.04% 38 4755 0.06% 39 7857 0.09% 40 13758 0.16% 41 3579 0.04% 42 3559 0.04% 43 5238 0.06% 44 8653 0.10% 45 15366 0.18% 46 3676 0.04% 47 4888 0.06% 48 7424 0.09% 49 13324 0.15% 50 24516 0.28% 51 5095 0.06% 52 6676 0.08% 53 10258 0.12% 54 18138 0.21% 55 34746 0.40% 56 6685 0.08% 57 8922 0.10% 58 13648 0.16% 59 25458 0.30% 60 52740 0.61% 61 8793 0.10% 62 11724 0.14% 63 17812 0.21% 64 31942 0.37% 65 59979 0.70% 66 10304 0.12% 67 30668 0.36% 68 8058410 93.59% 8609951 reads passed initial QC criterion=sequence-density sequence-density=0.03 sequence-density-rank=1 fanout-score=20.65 fanout-score-rank=14 prefix-density=0.09 prefix-fanout=7.7 sequence=AAGAAAAGAAAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=8 fanout-score=175.61 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=20.1 sequence=TTCTTCTTCTTC Started job on | Feb 10 22:09:27 Started mapping on | Feb 10 22:09:27 Finished on | Feb 10 22:09:35 Mapping speed, Million of reads per hour | 3874.48 Number of input reads | 8609951 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 8163895 Uniquely mapped reads % | 94.82% Average mapped length | 66.93 Number of splices: Total | 1538164 Number of splices: Annotated (sjdb) | 1513477 Number of splices: GT/AG | 1515217 Number of splices: GC/AG | 18981 Number of splices: AT/AC | 1685 Number of splices: Non-canonical | 2281 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.01% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 274648 % of reads mapped to multiple loci | 3.19% Number of reads mapped to too many loci | 127313 % of reads mapped to too many loci | 1.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 171408 171408 171408 N_multimapping 274648 274648 274648 N_noFeature 394180 4249964 4251461 N_ambiguous 81820 12385 12883 UnstrandedReadsAssigned:7687895 PositiveStrandReadsAssigned:3901546 NegativeStrandReadsAssigned:3899551 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207786 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207786-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,609,951 reads, 7,974,235 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR3207786.ke.tsv 34699 SRR3207786.se.tsv 87100 total ==> SRR3207786.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 191 18.1667 Potri.005G024800.1.v4.1 1035 936 31 6.04511 Potri.004G059700.1.v4.1 961 862 11 2.32918 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 113.919 7.31111 Potri.016G087400.1.v4.1 270 171 290 309.542 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 16.5407 1.8035 Potri.012G127500.1.v4.1 977 878 988 205.391 ==> SRR3207786.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 707 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 171 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 24 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR3207786 completed mapping pipeline successfully