Starting /dee2/code/volunteer_pipeline.sh SRR3207787 current disk space = 3057213878272 free memory = 1285775288 SRR3207787 SRAfilesize 2de2d586fb46eaa5a242411ce37ba931 SRR3207787.sra SRR3207787.sra file validated SRR3207787 is single end SRR3207787 is conventional basespace SRR3207787 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207787_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.6615 40.0 39.0 40.0 36.0 40.0 2 38.38325 40.0 39.0 40.0 36.0 40.0 3 38.474 40.0 39.0 40.0 35.0 40.0 4 38.412 40.0 39.0 40.0 35.0 40.0 5 38.43725 40.0 38.0 40.0 36.0 40.0 6 38.4335 40.0 38.0 40.0 35.0 40.0 7 38.40475 40.0 38.0 40.0 35.0 40.0 8 38.411 40.0 38.0 40.0 35.0 40.0 9 38.32675 40.0 38.0 40.0 35.0 40.0 10 38.2735 40.0 38.0 40.0 35.0 40.0 11 38.26575 40.0 38.0 40.0 35.0 40.0 12 38.20575 40.0 38.0 40.0 35.0 40.0 13 38.2125 40.0 38.0 40.0 35.0 40.0 14 38.1425 40.0 38.0 40.0 35.0 40.0 15 38.1055 40.0 38.0 40.0 35.0 40.0 16 38.111 40.0 38.0 40.0 35.0 40.0 17 38.051 40.0 38.0 40.0 35.0 40.0 18 37.95375 39.0 38.0 40.0 34.0 40.0 19 37.953 39.0 38.0 40.0 34.0 40.0 20 37.852 39.0 38.0 40.0 34.0 40.0 21 37.85175 39.0 38.0 40.0 34.0 40.0 22 37.80825 39.0 38.0 40.0 34.0 40.0 23 37.7555 39.0 38.0 40.0 33.0 40.0 24 37.70775 39.0 38.0 40.0 33.0 40.0 25 37.64525 39.0 38.0 40.0 33.0 40.0 26 37.55025 39.0 38.0 40.0 33.0 40.0 27 37.4675 39.0 38.0 40.0 33.0 40.0 28 37.41025 39.0 38.0 40.0 33.0 40.0 29 37.225 39.0 37.0 40.0 33.0 40.0 30 37.24325 39.0 37.0 40.0 33.0 40.0 31 37.134 39.0 37.0 40.0 33.0 40.0 32 36.95175 39.0 37.0 40.0 32.0 40.0 33 36.96925 39.0 37.0 40.0 32.0 40.0 34 36.9415 39.0 37.0 40.0 32.0 40.0 35 36.89675 39.0 36.0 40.0 32.0 40.0 36 36.91725 39.0 37.0 40.0 33.0 40.0 37 36.73225 39.0 36.0 40.0 32.0 40.0 38 36.5985 39.0 36.0 40.0 31.0 40.0 39 36.527 39.0 36.0 40.0 32.0 40.0 40 36.29375 39.0 36.0 40.0 31.0 40.0 41 36.3295 39.0 36.0 40.0 31.0 40.0 42 36.22275 39.0 36.0 40.0 31.0 40.0 43 36.1555 39.0 36.0 40.0 31.0 40.0 44 36.05725 39.0 36.0 40.0 31.0 40.0 45 35.96325 39.0 36.0 40.0 30.0 40.0 46 36.02425 39.0 36.0 40.0 31.0 40.0 47 35.78 39.0 36.0 39.0 30.0 40.0 48 35.6355 38.0 35.0 39.0 30.0 40.0 49 35.6195 38.0 35.0 39.0 30.0 40.0 50 35.40025 38.0 35.0 39.0 30.0 40.0 51 35.323 38.0 35.0 39.0 30.0 40.0 52 35.1675 38.0 35.0 39.0 29.0 40.0 53 34.90925 38.0 35.0 39.0 29.0 40.0 54 34.67275 38.0 34.0 39.0 29.0 40.0 55 34.61475 38.0 34.0 39.0 29.0 40.0 56 34.435 37.0 34.0 39.0 29.0 40.0 57 34.22075 37.0 33.0 39.0 28.0 39.0 58 34.051 36.0 33.0 39.0 28.0 39.0 59 33.99375 36.0 33.0 39.0 28.0 39.0 60 33.597 36.0 33.0 38.0 27.0 39.0 61 33.40875 36.0 33.0 38.0 26.0 39.0 62 33.22575 36.0 33.0 38.0 25.0 39.0 63 32.96625 36.0 33.0 38.0 25.0 39.0 64 32.7555 36.0 33.0 38.0 25.0 39.0 65 32.52225 36.0 33.0 38.0 23.0 39.0 66 32.10325 36.0 33.0 38.0 22.0 39.0 67 31.9865 35.0 32.0 38.0 21.0 39.0 68 31.3525 35.0 31.0 38.0 18.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 2.0 5 0.0 6 1.0 7 2.0 8 2.0 9 5.0 10 3.0 11 8.0 12 9.0 13 6.0 14 10.0 15 8.0 16 5.0 17 14.0 18 14.0 19 12.0 20 8.0 21 12.0 22 17.0 23 9.0 24 19.0 25 16.0 26 21.0 27 35.0 28 33.0 29 37.0 30 48.0 31 59.0 32 85.0 33 118.0 34 138.0 35 201.0 36 295.0 37 603.0 38 1151.0 39 986.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.900000000000002 15.35 13.925 43.824999999999996 2 19.001004016064257 22.590361445783135 37.8012048192771 20.6074297188755 3 20.95 26.724999999999998 27.500000000000004 24.825 4 25.124999999999996 32.45 20.424999999999997 22.0 5 25.5 35.35 22.375 16.775000000000002 6 17.299999999999997 38.2 25.025 19.475 7 17.00425106276569 18.904726181545385 42.51062765691423 21.580395098774694 8 18.35 23.65 30.8 27.200000000000003 9 20.474999999999998 21.875 31.75 25.900000000000002 10 19.275000000000002 38.6 23.825 18.3 11 25.45 29.15 21.475 23.925 12 20.974999999999998 24.375 30.225 24.425 13 19.75 28.675 31.025000000000002 20.549999999999997 14 20.4 27.775 29.25 22.575 15 21.224999999999998 28.4 28.325 22.05 16 21.099999999999998 28.475 28.050000000000004 22.375 17 22.275 27.875 27.375 22.475 18 21.625 29.375 26.6 22.400000000000002 19 21.75 28.15 27.425 22.675 20 22.175 27.825 27.575 22.425 21 21.9 28.199999999999996 27.500000000000004 22.400000000000002 22 21.349999999999998 29.2 28.050000000000004 21.4 23 22.45 28.575 27.474999999999998 21.5 24 20.599999999999998 28.599999999999998 28.000000000000004 22.8 25 21.224999999999998 29.475 27.325 21.975 26 21.65 28.4 27.450000000000003 22.5 27 21.325 28.575 27.425 22.675 28 21.155288822205552 29.182295573893473 27.956989247311824 21.705426356589147 29 20.925 30.049999999999997 28.325 20.7 30 20.225 27.925 28.725 23.125 31 22.3 28.65 27.05 22.0 32 22.5 28.449999999999996 26.275 22.775000000000002 33 20.349999999999998 28.549999999999997 28.675 22.425 34 20.549999999999997 28.7 27.925 22.825 35 21.6 28.925 27.675 21.8 36 20.724999999999998 29.5 26.75 23.025000000000002 37 21.6 29.475 28.225 20.7 38 21.2 28.575 28.775000000000002 21.45 39 21.2 29.099999999999998 27.900000000000002 21.8 40 22.425 27.925 27.1 22.55 41 21.075 28.675 27.775 22.475 42 20.775 28.775000000000002 28.050000000000004 22.400000000000002 43 21.825 28.1 27.150000000000002 22.925 44 20.150000000000002 28.299999999999997 29.725 21.825 45 20.325 27.125 28.95 23.599999999999998 46 21.6 26.375 28.999999999999996 23.025000000000002 47 21.75 27.725 28.050000000000004 22.475 48 20.875 28.375 28.1 22.650000000000002 49 21.55 27.700000000000003 29.049999999999997 21.7 50 22.650000000000002 28.225 28.375 20.75 51 21.675 27.875 28.125 22.325 52 22.2 28.449999999999996 27.725 21.625 53 21.55 28.475 28.325 21.65 54 21.525 27.85 28.575 22.05 55 21.825 28.7 27.425 22.05 56 22.125 27.725 29.25 20.9 57 20.849999999999998 27.725 27.450000000000003 23.974999999999998 58 22.35 27.875 29.075 20.7 59 23.0 27.500000000000004 27.55 21.95 60 21.5 29.075 27.450000000000003 21.975 61 22.15 28.275 26.950000000000003 22.625 62 21.6 28.925 27.275 22.2 63 21.275 28.625 27.250000000000004 22.85 64 20.525 29.325000000000003 27.275 22.875 65 22.15 29.75 26.625 21.475 66 20.349999999999998 29.025000000000002 29.075 21.55 67 22.25 27.400000000000002 29.049999999999997 21.3 68 23.775 27.500000000000004 27.450000000000003 21.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 3.0 21 3.0 22 1.0 23 2.5 24 6.0 25 8.0 26 11.5 27 23.5 28 32.0 29 30.0 30 37.5 31 47.0 32 62.5 33 89.0 34 100.0 35 122.5 36 168.0 37 191.0 38 212.5 39 251.0 40 307.0 41 346.0 42 344.0 43 360.0 44 378.0 45 368.0 46 351.0 47 344.0 48 318.0 49 253.0 50 214.0 51 167.5 52 132.5 53 144.0 54 124.0 55 88.0 56 72.0 57 55.5 58 33.0 59 27.0 60 23.0 61 16.5 62 14.0 63 10.0 64 6.0 65 3.5 66 1.0 67 3.5 68 4.0 69 2.0 70 1.5 71 1.5 72 2.0 73 1.5 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.025 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.075 0.0 0.0 0.0 0.0 27 0.075 0.0 0.0 0.0 0.0 28 0.075 0.0 0.0 0.0 0.0 29 0.075 0.0 0.0 0.0 0.0 30 0.075 0.0 0.0 0.0 0.0 31 0.075 0.0 0.0 0.0 0.0 32 0.075 0.0 0.0 0.0 0.0 33 0.075 0.0 0.0 0.0 0.0 34 0.075 0.0 0.0 0.0 0.0 35 0.075 0.0 0.0 0.0 0.0 36 0.075 0.0 0.0 0.0 0.0 37 0.075 0.0 0.0 0.0 0.0 38 0.075 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 41 0.1 0.0 0.0 0.0 0.0 42 0.1 0.0 0.0 0.0 0.0 43 0.1 0.0 0.0 0.0 0.0 44 0.1 0.0 0.0 0.0 0.0 45 0.1 0.0 0.0 0.0 0.0 46 0.1 0.0 0.0 0.0 0.0 47 0.1 0.0 0.0 0.0 0.0 48 0.1 0.0 0.0 0.0 0.0 49 0.1 0.0 0.0 0.0 0.0 50 0.1 0.0 0.0 0.0 0.0 51 0.1 0.0 0.0 0.0 0.0 52 0.1 0.0 0.0 0.0 0.0 53 0.1 0.0 0.0 0.0 0.0 54 0.1 0.0 0.0 0.0 0.0 55 0.1 0.0 0.0 0.0 0.0 56 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336729 spots for SRR3207787.sra Written 336729 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra Read 336728 spots for SRR3207787.sra Written 336728 spots for SRR3207787.sra SRR ids: ['SRR3207787.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7_ta39hj SRR3207787.sra spots: 6734561 blocks: [[1, 336728], [336729, 673456], [673457, 1010184], [1010185, 1346912], [1346913, 1683640], [1683641, 2020368], [2020369, 2357096], [2357097, 2693824], [2693825, 3030552], [3030553, 3367280], [3367281, 3704008], [3704009, 4040736], [4040737, 4377464], [4377465, 4714192], [4714193, 5050920], [5050921, 5387648], [5387649, 5724376], [5724377, 6061104], [6061105, 6397832], [6397833, 6734561]] SRR3207787 file size 1420668 SRR3207787 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207787 SRR3207787_1.fastq Input file: SRR3207787_1.fastq trimmed: SRR3207787-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 22:11:27 2025 >> started Mon Feb 10 22:11:30 2025 >> done (2.817s) 6734561 reads processed; of these: 11428 ( 0.17%) short reads filtered out after trimming by size control 11459 ( 0.17%) empty reads filtered out after trimming by size control 6711674 (99.66%) reads available; of these: 417152 ( 6.22%) trimmed reads available after processing 6294522 (93.78%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1094 0.02% 19 1749 0.03% 20 3045 0.05% 21 1008 0.02% 22 1266 0.02% 23 2009 0.03% 24 3356 0.05% 25 6375 0.09% 26 1520 0.02% 27 1912 0.03% 28 2612 0.04% 29 4171 0.06% 30 7462 0.11% 31 1778 0.03% 32 2319 0.03% 33 2666 0.04% 34 4346 0.06% 35 7591 0.11% 36 1862 0.03% 37 2482 0.04% 38 3517 0.05% 39 5872 0.09% 40 10321 0.15% 41 2699 0.04% 42 2678 0.04% 43 3719 0.06% 44 6523 0.10% 45 11416 0.17% 46 2681 0.04% 47 3657 0.05% 48 5669 0.08% 49 10029 0.15% 50 18199 0.27% 51 3867 0.06% 52 4967 0.07% 53 7665 0.11% 54 13848 0.21% 55 26477 0.39% 56 5088 0.08% 57 6704 0.10% 58 10481 0.16% 59 19209 0.29% 60 40335 0.60% 61 6642 0.10% 62 8775 0.13% 63 13246 0.20% 64 24499 0.37% 65 45863 0.68% 66 8052 0.12% 67 23831 0.36% 68 6294522 93.78% 6711674 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=1.91 fanout-score-rank=40 prefix-density=0.04 prefix-fanout=1.9 sequence=CCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=185.83 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=20.0 sequence=TTCTTCTTCTTT Started job on | Feb 10 22:11:45 Started mapping on | Feb 10 22:11:46 Finished on | Feb 10 22:11:52 Mapping speed, Million of reads per hour | 4027.00 Number of input reads | 6711674 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 6405492 Uniquely mapped reads % | 95.44% Average mapped length | 67.00 Number of splices: Total | 1260412 Number of splices: Annotated (sjdb) | 1240367 Number of splices: GT/AG | 1241891 Number of splices: GC/AG | 15537 Number of splices: AT/AC | 1503 Number of splices: Non-canonical | 1481 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.75 Insertion rate per base | 0.01% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 207235 % of reads mapped to multiple loci | 3.09% Number of reads mapped to too many loci | 79397 % of reads mapped to too many loci | 1.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.26% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 98947 98947 98947 N_multimapping 207235 207235 207235 N_noFeature 282555 3303980 3343182 N_ambiguous 60264 9538 9917 UnstrandedReadsAssigned:6062673 PositiveStrandReadsAssigned:3091974 NegativeStrandReadsAssigned:3052393 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207787 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207787-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,711,674 reads, 6,257,335 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52401 SRR3207787.ke.tsv 34699 SRR3207787.se.tsv 87100 total ==> SRR3207787.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 159 19.3973 Potri.005G024800.1.v4.1 1035 936 17 4.25199 Potri.004G059700.1.v4.1 961 862 9 2.4443 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 95.1234 7.83027 Potri.016G087400.1.v4.1 270 171 230 314.884 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 14.0123 1.95962 Potri.012G127500.1.v4.1 977 878 768 204.779 ==> SRR3207787.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 845 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 123 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207787 completed mapping pipeline successfully