Starting /dee2/code/volunteer_pipeline.sh SRR3207788 current disk space = 3057736011776 free memory = 1580018608 SRR3207788 SRAfilesize 67f3f8ab5a14c82d4b2270bc25735792 SRR3207788.sra SRR3207788.sra file validated SRR3207788 is single end SRR3207788 is conventional basespace SRR3207788 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207788_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.6195 40.0 39.0 40.0 35.0 40.0 2 38.30525 40.0 38.0 40.0 35.0 40.0 3 38.41175 40.0 38.0 40.0 35.0 40.0 4 38.342 40.0 38.0 40.0 35.0 40.0 5 38.3365 40.0 38.0 40.0 35.0 40.0 6 38.402 40.0 38.0 40.0 35.0 40.0 7 38.3815 40.0 38.0 40.0 35.0 40.0 8 38.3275 40.0 38.0 40.0 35.0 40.0 9 38.33375 40.0 38.0 40.0 35.0 40.0 10 38.21475 40.0 38.0 40.0 35.0 40.0 11 38.27625 40.0 38.0 40.0 35.0 40.0 12 38.21175 40.0 38.0 40.0 35.0 40.0 13 38.1165 39.0 38.0 40.0 35.0 40.0 14 38.11075 40.0 38.0 40.0 35.0 40.0 15 38.0895 39.0 38.0 40.0 35.0 40.0 16 38.045 39.0 38.0 40.0 35.0 40.0 17 37.92 39.0 38.0 40.0 34.0 40.0 18 37.92 39.0 38.0 40.0 34.0 40.0 19 37.91475 39.0 38.0 40.0 33.0 40.0 20 37.8795 39.0 38.0 40.0 34.0 40.0 21 37.9085 39.0 38.0 40.0 34.0 40.0 22 37.79925 39.0 38.0 40.0 33.0 40.0 23 37.70775 39.0 38.0 40.0 33.0 40.0 24 37.6445 39.0 38.0 40.0 33.0 40.0 25 37.645 39.0 38.0 40.0 33.0 40.0 26 37.5625 39.0 38.0 40.0 33.0 40.0 27 37.431 39.0 38.0 40.0 33.0 40.0 28 37.33175 39.0 38.0 40.0 33.0 40.0 29 37.2085 39.0 37.0 40.0 33.0 40.0 30 37.16975 39.0 37.0 40.0 33.0 40.0 31 37.1285 39.0 37.0 40.0 33.0 40.0 32 36.95575 39.0 36.0 40.0 32.0 40.0 33 37.019 39.0 37.0 40.0 32.0 40.0 34 36.88275 39.0 37.0 40.0 32.0 40.0 35 36.898 39.0 36.0 40.0 32.0 40.0 36 36.86425 39.0 36.0 40.0 32.0 40.0 37 36.67925 39.0 36.0 40.0 31.0 40.0 38 36.5975 39.0 36.0 40.0 32.0 40.0 39 36.52025 39.0 36.0 40.0 31.0 40.0 40 36.335 39.0 36.0 40.0 31.0 40.0 41 36.3915 39.0 36.0 40.0 31.0 40.0 42 36.40425 39.0 36.0 40.0 31.0 40.0 43 36.31075 39.0 36.0 40.0 31.0 40.0 44 36.16975 39.0 36.0 40.0 31.0 40.0 45 36.0185 39.0 36.0 40.0 30.0 40.0 46 36.062 39.0 36.0 40.0 31.0 40.0 47 35.975 39.0 36.0 40.0 31.0 40.0 48 35.789 38.0 35.0 39.0 30.0 40.0 49 35.668 38.0 35.0 39.0 30.0 40.0 50 35.5585 38.0 35.0 39.0 30.0 40.0 51 35.293 38.0 35.0 39.0 29.0 40.0 52 35.18225 38.0 35.0 39.0 29.0 40.0 53 34.96975 38.0 35.0 39.0 29.0 40.0 54 34.81175 38.0 35.0 39.0 29.0 40.0 55 34.521 38.0 34.0 39.0 29.0 40.0 56 34.356 38.0 34.0 39.0 27.0 40.0 57 34.149 37.0 34.0 39.0 27.0 40.0 58 33.9825 37.0 33.0 39.0 27.0 39.0 59 33.73725 37.0 33.0 39.0 25.0 39.0 60 33.67775 36.0 33.0 39.0 26.0 39.0 61 33.3395 36.0 33.0 39.0 25.0 39.0 62 33.14975 36.0 33.0 39.0 24.0 39.0 63 32.92675 36.0 33.0 38.0 23.0 39.0 64 32.6925 36.0 33.0 38.0 23.0 39.0 65 32.45775 36.0 33.0 38.0 21.0 39.0 66 32.34075 36.0 33.0 38.0 19.0 39.0 67 32.0 36.0 32.0 38.0 17.0 39.0 68 31.5625 35.0 32.0 38.0 16.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 1.0 5 0.0 6 2.0 7 2.0 8 3.0 9 0.0 10 10.0 11 3.0 12 5.0 13 5.0 14 15.0 15 8.0 16 10.0 17 10.0 18 11.0 19 9.0 20 13.0 21 9.0 22 11.0 23 16.0 24 19.0 25 20.0 26 31.0 27 33.0 28 38.0 29 56.0 30 60.0 31 75.0 32 61.0 33 103.0 34 149.0 35 195.0 36 314.0 37 544.0 38 1058.0 39 1097.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.107026756689173 14.753688422105526 15.453863465866466 41.68542135533884 2 21.295831240582622 22.124560522350578 34.27925665494726 22.30035158211954 3 23.5 24.85 27.05 24.6 4 25.575 29.925 21.45 23.05 5 25.1 34.449999999999996 23.525 16.925 6 19.775000000000002 35.475 25.1 19.650000000000002 7 17.5 18.6 44.425 19.475 8 17.75 23.775 31.65 26.825 9 20.125 22.95 33.6 23.325000000000003 10 19.375 38.275 25.45 16.900000000000002 11 24.325 29.275000000000002 22.8 23.599999999999998 12 20.724999999999998 25.424999999999997 29.275000000000002 24.575 13 19.5 29.225 31.374999999999996 19.900000000000002 14 20.150000000000002 28.799999999999997 29.625 21.425 15 21.224999999999998 28.025 29.375 21.375 16 22.400000000000002 28.275 27.200000000000003 22.125 17 22.25 28.849999999999998 27.55 21.349999999999998 18 22.125 28.299999999999997 28.599999999999998 20.974999999999998 19 22.55 27.675 28.249999999999996 21.525 20 21.224999999999998 28.249999999999996 28.849999999999998 21.675 21 22.75 27.925 27.525 21.8 22 21.575 29.675 26.825 21.925 23 21.875 29.4 27.925 20.8 24 21.224999999999998 28.975 27.6 22.2 25 21.625 28.975 27.925 21.475 26 21.075 27.800000000000004 28.499999999999996 22.625 27 21.05 27.3 29.099999999999998 22.55 28 21.325 27.975 28.599999999999998 22.1 29 21.9 27.950000000000003 27.700000000000003 22.45 30 22.175 28.225 28.050000000000004 21.55 31 21.525 27.0 27.525 23.95 32 21.675 28.775000000000002 28.249999999999996 21.3 33 22.35 27.700000000000003 27.975 21.975 34 22.825 27.35 27.474999999999998 22.35 35 21.725 26.974999999999998 28.9 22.400000000000002 36 22.575 27.474999999999998 27.224999999999998 22.725 37 22.875 27.55 28.025 21.55 38 22.075 27.900000000000002 28.575 21.45 39 21.425 27.425 28.299999999999997 22.85 40 21.2 27.05 29.799999999999997 21.95 41 20.525 28.599999999999998 28.625 22.25 42 21.25 27.725 28.9 22.125 43 21.224999999999998 28.675 28.175 21.925 44 21.4 27.275 29.225 22.1 45 22.575 27.3 27.425 22.7 46 22.8 26.450000000000003 27.875 22.875 47 23.400000000000002 27.575 27.800000000000004 21.224999999999998 48 21.925 28.249999999999996 28.925 20.9 49 21.85 27.025 27.85 23.275000000000002 50 22.575 26.8 28.975 21.65 51 22.650000000000002 27.474999999999998 26.924999999999997 22.95 52 23.1 27.825 26.650000000000002 22.425 53 21.25 28.95 28.849999999999998 20.95 54 22.15 27.900000000000002 27.750000000000004 22.2 55 22.3 27.900000000000002 28.1 21.7 56 23.05 27.150000000000002 28.549999999999997 21.25 57 22.35 29.025000000000002 27.375 21.25 58 22.3 27.650000000000002 27.500000000000004 22.55 59 22.0 28.325 27.525 22.15 60 21.3 28.625 29.125 20.95 61 22.025 27.35 27.775 22.85 62 21.725 27.425 27.725 23.125 63 21.4 28.175 27.750000000000004 22.675 64 21.025 28.175 28.925 21.875 65 21.15 28.299999999999997 29.025000000000002 21.525 66 21.2 28.849999999999998 27.05 22.900000000000002 67 20.75 29.799999999999997 27.400000000000002 22.05 68 22.3 28.725 27.200000000000003 21.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 17.0 1 8.5 2 0.5 3 1.0 4 1.0 5 1.5 6 2.0 7 2.0 8 1.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 1.5 16 3.0 17 2.5 18 2.0 19 2.0 20 3.0 21 4.5 22 5.0 23 6.0 24 7.0 25 7.0 26 13.0 27 26.5 28 34.0 29 30.0 30 32.0 31 38.0 32 48.5 33 69.0 34 79.0 35 100.0 36 142.0 37 163.0 38 188.5 39 250.5 40 300.5 41 314.0 42 326.0 43 351.5 44 365.0 45 369.5 46 340.0 47 306.0 48 298.5 49 271.5 50 252.0 51 237.5 52 178.0 53 133.0 54 122.0 55 84.0 56 57.0 57 49.5 58 40.0 59 38.0 60 32.5 61 19.5 62 12.0 63 9.5 64 6.5 65 4.5 66 3.0 67 2.0 68 2.0 69 3.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72243250063083 98.8 2 0.22710068130204392 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05046681806712087 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCTTATCTCGTATGCCGTCTTCTGCTTGAAA 16 0.4 TruSeq Adapter, Index 20 (97% over 44bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 14 0.35000000000000003 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.05 0.0 0.0 0.0 0.0 52 0.05 0.0 0.0 0.0 0.0 53 0.05 0.0 0.0 0.0 0.0 54 0.05 0.0 0.0 0.0 0.0 55 0.05 0.0 0.0 0.0 0.0 56 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra Read 200115 spots for SRR3207788.sra Written 200115 spots for SRR3207788.sra SRR ids: ['SRR3207788.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1x1rpap0 SRR3207788.sra spots: 4002300 blocks: [[1, 200115], [200116, 400230], [400231, 600345], [600346, 800460], [800461, 1000575], [1000576, 1200690], [1200691, 1400805], [1400806, 1600920], [1600921, 1801035], [1801036, 2001150], [2001151, 2201265], [2201266, 2401380], [2401381, 2601495], [2601496, 2801610], [2801611, 3001725], [3001726, 3201840], [3201841, 3401955], [3401956, 3602070], [3602071, 3802185], [3802186, 4002300]] SRR3207788 file size 843830 SRR3207788 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207788 SRR3207788_1.fastq Input file: SRR3207788_1.fastq trimmed: SRR3207788-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 23:15:04 2025 >> started Mon Feb 10 23:15:06 2025 >> done (1.898s) 4002300 reads processed; of these: 5978 ( 0.15%) short reads filtered out after trimming by size control 23875 ( 0.60%) empty reads filtered out after trimming by size control 3972447 (99.25%) reads available; of these: 246434 ( 6.20%) trimmed reads available after processing 3726013 (93.80%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 688 0.02% 19 1219 0.03% 20 2050 0.05% 21 568 0.01% 22 806 0.02% 23 1302 0.03% 24 2163 0.05% 25 4050 0.10% 26 829 0.02% 27 1067 0.03% 28 1622 0.04% 29 2851 0.07% 30 4937 0.12% 31 1134 0.03% 32 1462 0.04% 33 1817 0.05% 34 2893 0.07% 35 5083 0.13% 36 1108 0.03% 37 1533 0.04% 38 2180 0.05% 39 3652 0.09% 40 6533 0.16% 41 1595 0.04% 42 1559 0.04% 43 2332 0.06% 44 3931 0.10% 45 7125 0.18% 46 1636 0.04% 47 2220 0.06% 48 3383 0.09% 49 6012 0.15% 50 11284 0.28% 51 2248 0.06% 52 3020 0.08% 53 4677 0.12% 54 8214 0.21% 55 16183 0.41% 56 2979 0.07% 57 4018 0.10% 58 6159 0.16% 59 11218 0.28% 60 24204 0.61% 61 3886 0.10% 62 5042 0.13% 63 7669 0.19% 64 13757 0.35% 65 25540 0.64% 66 3958 0.10% 67 11038 0.28% 68 3726013 93.80% 3972447 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=24 prefix-density=0.05 prefix-fanout=2.4 sequence=CCACCAAAACACAAATCCTA criterion=fanout-score sequence-density=0.03 sequence-density-rank=17 fanout-score=225.26 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=22.0 sequence=TTCTTCTTCTTT Started job on | Feb 10 23:15:25 Started mapping on | Feb 10 23:15:25 Finished on | Feb 10 23:15:30 Mapping speed, Million of reads per hour | 2860.16 Number of input reads | 3972447 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 3782267 Uniquely mapped reads % | 95.21% Average mapped length | 67.02 Number of splices: Total | 717941 Number of splices: Annotated (sjdb) | 706038 Number of splices: GT/AG | 707276 Number of splices: GC/AG | 9012 Number of splices: AT/AC | 840 Number of splices: Non-canonical | 813 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 1.85 Insertion rate per base | 0.01% Insertion average length | 1.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 127176 % of reads mapped to multiple loci | 3.20% Number of reads mapped to too many loci | 39196 % of reads mapped to too many loci | 0.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.36% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 63004 63004 63004 N_multimapping 127176 127176 127176 N_noFeature 142640 1928377 1970296 N_ambiguous 36848 5285 5357 UnstrandedReadsAssigned:3602779 PositiveStrandReadsAssigned:1848605 NegativeStrandReadsAssigned:1806614 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207788 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207788-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,972,447 reads, 3,716,788 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR3207788.ke.tsv 34699 SRR3207788.se.tsv 87100 total ==> SRR3207788.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 133.511 26.6211 Potri.005G024800.1.v4.1 1035 936 22 8.99353 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 63.5327 8.54774 Potri.016G087400.1.v4.1 270 171 188 420.673 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 18 4.11434 Potri.012G127500.1.v4.1 977 878 689 300.267 ==> SRR3207788.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 523 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 59 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR3207788 completed mapping pipeline successfully