Starting /dee2/code/volunteer_pipeline.sh SRR3207789 current disk space = 3057736011776 free memory = 1580020436 SRR3207789 SRAfilesize c726fa980ae835da3939eda6fa3c4fb1 SRR3207789.sra SRR3207789.sra file validated SRR3207789 is single end SRR3207789 is conventional basespace SRR3207789 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207789_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.7435 40.0 39.0 40.0 36.0 40.0 2 38.467 40.0 39.0 40.0 36.0 40.0 3 38.53725 40.0 39.0 40.0 36.0 40.0 4 38.50975 40.0 39.0 40.0 35.0 40.0 5 38.51975 40.0 39.0 40.0 35.0 40.0 6 38.4895 40.0 39.0 40.0 35.0 40.0 7 38.535 40.0 39.0 40.0 36.0 40.0 8 38.462 40.0 38.0 40.0 35.0 40.0 9 38.43525 40.0 38.0 40.0 35.0 40.0 10 38.38575 40.0 38.0 40.0 35.0 40.0 11 38.33475 40.0 38.0 40.0 35.0 40.0 12 38.2985 40.0 38.0 40.0 35.0 40.0 13 38.29725 40.0 38.0 40.0 35.0 40.0 14 38.1935 40.0 38.0 40.0 35.0 40.0 15 38.22625 40.0 38.0 40.0 35.0 40.0 16 38.212 40.0 38.0 40.0 35.0 40.0 17 38.10375 40.0 38.0 40.0 35.0 40.0 18 38.09725 39.0 38.0 40.0 35.0 40.0 19 38.0785 39.0 38.0 40.0 35.0 40.0 20 37.98575 39.0 38.0 40.0 34.0 40.0 21 38.04225 39.0 38.0 40.0 35.0 40.0 22 38.01375 39.0 38.0 40.0 35.0 40.0 23 37.86125 39.0 38.0 40.0 33.0 40.0 24 37.81275 39.0 38.0 40.0 33.0 40.0 25 37.78975 39.0 38.0 40.0 33.0 40.0 26 37.77075 39.0 38.0 40.0 33.0 40.0 27 37.63125 39.0 38.0 40.0 33.0 40.0 28 37.48725 39.0 38.0 40.0 33.0 40.0 29 37.4445 39.0 38.0 40.0 33.0 40.0 30 37.442 39.0 38.0 40.0 33.0 40.0 31 37.339 39.0 38.0 40.0 33.0 40.0 32 37.22275 39.0 37.0 40.0 33.0 40.0 33 37.226 39.0 37.0 40.0 33.0 40.0 34 37.115 39.0 37.0 40.0 33.0 40.0 35 37.22075 39.0 37.0 40.0 33.0 40.0 36 37.0405 39.0 37.0 40.0 33.0 40.0 37 36.96575 39.0 37.0 40.0 32.0 40.0 38 36.882 39.0 36.0 40.0 32.0 40.0 39 36.70675 39.0 36.0 40.0 32.0 40.0 40 36.6235 39.0 36.0 40.0 31.0 40.0 41 36.6745 39.0 36.0 40.0 32.0 40.0 42 36.5985 39.0 36.0 40.0 32.0 40.0 43 36.5925 39.0 36.0 40.0 32.0 40.0 44 36.425 39.0 36.0 40.0 31.0 40.0 45 36.306 39.0 36.0 40.0 31.0 40.0 46 36.3745 39.0 36.0 40.0 32.0 40.0 47 36.27 39.0 36.0 40.0 31.0 40.0 48 36.1575 39.0 36.0 40.0 31.0 40.0 49 35.99625 38.0 36.0 39.0 31.0 40.0 50 35.8705 38.0 35.0 39.0 30.0 40.0 51 35.66175 38.0 35.0 39.0 30.0 40.0 52 35.657 38.0 35.0 39.0 31.0 40.0 53 35.43275 38.0 35.0 39.0 30.0 40.0 54 35.2675 38.0 35.0 39.0 30.0 40.0 55 35.0505 38.0 35.0 39.0 30.0 40.0 56 34.98625 38.0 35.0 39.0 30.0 40.0 57 34.72875 38.0 35.0 39.0 29.0 40.0 58 34.58125 37.0 34.0 39.0 29.0 40.0 59 34.43425 37.0 34.0 39.0 29.0 40.0 60 34.20725 36.0 33.0 39.0 29.0 39.0 61 34.0185 37.0 34.0 39.0 28.0 39.0 62 33.85225 36.0 33.0 39.0 28.0 39.0 63 33.63275 36.0 33.0 38.0 27.0 39.0 64 33.40475 36.0 33.0 38.0 27.0 39.0 65 33.2155 36.0 33.0 38.0 26.0 39.0 66 32.99 36.0 33.0 38.0 25.0 39.0 67 32.7135 36.0 33.0 38.0 24.0 39.0 68 32.27525 35.0 32.0 38.0 23.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 2.0 6 1.0 7 3.0 8 2.0 9 0.0 10 7.0 11 4.0 12 9.0 13 6.0 14 5.0 15 10.0 16 7.0 17 15.0 18 6.0 19 5.0 20 9.0 21 8.0 22 15.0 23 12.0 24 23.0 25 22.0 26 25.0 27 35.0 28 24.0 29 36.0 30 35.0 31 46.0 32 74.0 33 100.0 34 131.0 35 199.0 36 299.0 37 565.0 38 1076.0 39 1183.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.775 15.975 12.625 43.625 2 20.30112923462986 21.3801756587202 37.36511919698871 20.95357590966123 3 22.525000000000002 24.975 27.325 25.174999999999997 4 25.025 32.4 21.0 21.575 5 25.974999999999998 34.4 21.75 17.875 6 18.375 36.825 24.975 19.825 7 17.10855427713857 18.25912956478239 44.122061030515255 20.51025512756378 8 18.825 25.174999999999997 29.825000000000003 26.174999999999997 9 18.5 21.9 33.15 26.450000000000003 10 18.75 38.574999999999996 24.525 18.15 11 23.875 29.975 21.5 24.65 12 21.55 24.6 30.15 23.7 13 20.200000000000003 28.349999999999998 31.4 20.05 14 21.425 28.349999999999998 27.975 22.25 15 20.150000000000002 29.275000000000002 27.35 23.225 16 22.0 28.050000000000004 28.249999999999996 21.7 17 21.575 28.775000000000002 28.375 21.275 18 23.1 28.15 26.3 22.45 19 22.75 29.275000000000002 26.650000000000002 21.325 20 21.25 29.799999999999997 26.950000000000003 22.0 21 20.525 28.4 28.4 22.675 22 20.724999999999998 28.9 28.575 21.8 23 20.925 28.525 28.625 21.925 24 21.075 27.800000000000004 27.35 23.775 25 20.75 27.875 28.825 22.55 26 21.675 28.15 28.825 21.349999999999998 27 21.360680340170084 26.613306653326664 28.53926963481741 23.486743371685844 28 21.99149362021516 29.246935201401055 26.044533400050035 22.71703777833375 29 21.885942971485743 29.41470735367684 26.988494247123562 21.710855427713856 30 21.260630315157577 27.613806903451728 28.189094547273637 22.936468234117058 31 21.15 27.35 28.125 23.375 32 20.8 27.675 28.875 22.650000000000002 33 21.95 26.3 27.750000000000004 24.0 34 20.95 27.900000000000002 28.549999999999997 22.6 35 21.6 29.7 27.224999999999998 21.475 36 22.275 27.625 27.474999999999998 22.625 37 20.775 29.425 27.750000000000004 22.05 38 22.55 28.599999999999998 27.875 20.974999999999998 39 20.9 28.499999999999996 27.375 23.225 40 21.475 29.525000000000002 26.275 22.725 41 22.400000000000002 30.075000000000003 26.35 21.175 42 22.1 28.425 27.875 21.6 43 22.0 27.425 27.400000000000002 23.175 44 21.575 28.575 27.55 22.3 45 20.175 29.025000000000002 28.325 22.475 46 23.150000000000002 27.375 27.250000000000004 22.225 47 22.1 28.849999999999998 27.35 21.7 48 22.0 27.775 27.825 22.400000000000002 49 20.925 28.599999999999998 28.775000000000002 21.7 50 22.475 28.575 27.450000000000003 21.5 51 22.225 28.025 27.700000000000003 22.05 52 21.775 27.450000000000003 27.775 23.0 53 21.3 28.7 27.825 22.175 54 21.925 28.299999999999997 27.275 22.5 55 21.15 28.599999999999998 27.450000000000003 22.8 56 21.45 29.2 28.175 21.175 57 22.175 27.375 28.449999999999996 22.0 58 22.85 27.750000000000004 27.875 21.525 59 21.475 27.750000000000004 28.000000000000004 22.775000000000002 60 21.125 28.050000000000004 28.599999999999998 22.225 61 21.425 27.1 29.099999999999998 22.375 62 22.15 26.825 28.325 22.7 63 22.3 27.725 28.875 21.099999999999998 64 22.925 27.35 27.775 21.95 65 23.0 27.6 26.6 22.8 66 21.775 28.675 27.05 22.5 67 21.625 27.85 28.575 21.95 68 21.775 29.075 27.625 21.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 2.0 22 4.0 23 4.0 24 4.0 25 4.0 26 7.0 27 12.5 28 15.0 29 25.5 30 35.0 31 34.0 32 50.0 33 83.0 34 100.0 35 103.0 36 143.0 37 180.0 38 204.5 39 273.5 40 347.0 41 376.0 42 346.5 43 352.0 44 387.0 45 375.0 46 357.5 47 352.0 48 293.5 49 244.0 50 253.0 51 214.5 52 162.5 53 149.0 54 123.5 55 86.5 56 75.0 57 59.5 58 36.0 59 28.0 60 22.0 61 13.0 62 10.0 63 7.5 64 3.0 65 3.0 66 5.0 67 2.5 68 0.0 69 0.0 70 0.0 71 1.0 72 2.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.05 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.05 28 0.075 29 0.05 30 0.05 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 41 0.025 0.0 0.0 0.0 0.0 42 0.025 0.0 0.0 0.0 0.0 43 0.025 0.0 0.0 0.0 0.0 44 0.025 0.0 0.0 0.0 0.0 45 0.025 0.0 0.0 0.0 0.0 46 0.025 0.0 0.0 0.0 0.0 47 0.025 0.0 0.0 0.0 0.0 48 0.025 0.0 0.0 0.0 0.0 49 0.025 0.0 0.0 0.0 0.0 50 0.025 0.0 0.0 0.0 0.0 51 0.025 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra Read 227489 spots for SRR3207789.sra Written 227489 spots for SRR3207789.sra SRR ids: ['SRR3207789.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_749llitq SRR3207789.sra spots: 4549780 blocks: [[1, 227489], [227490, 454978], [454979, 682467], [682468, 909956], [909957, 1137445], [1137446, 1364934], [1364935, 1592423], [1592424, 1819912], [1819913, 2047401], [2047402, 2274890], [2274891, 2502379], [2502380, 2729868], [2729869, 2957357], [2957358, 3184846], [3184847, 3412335], [3412336, 3639824], [3639825, 3867313], [3867314, 4094802], [4094803, 4322291], [4322292, 4549780]] SRR3207789 file size 959413 SRR3207789 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207789 SRR3207789_1.fastq Input file: SRR3207789_1.fastq trimmed: SRR3207789-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 23:15:07 2025 >> started Mon Feb 10 23:15:10 2025 >> done (2.410s) 4549780 reads processed; of these: 5633 ( 0.12%) short reads filtered out after trimming by size control 6820 ( 0.15%) empty reads filtered out after trimming by size control 4537327 (99.73%) reads available; of these: 247496 ( 5.45%) trimmed reads available after processing 4289831 (94.55%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 632 0.01% 19 1014 0.02% 20 1830 0.04% 21 538 0.01% 22 719 0.02% 23 1143 0.03% 24 1955 0.04% 25 3456 0.08% 26 826 0.02% 27 983 0.02% 28 1504 0.03% 29 2471 0.05% 30 4461 0.10% 31 1106 0.02% 32 1349 0.03% 33 1636 0.04% 34 2692 0.06% 35 4737 0.10% 36 1136 0.03% 37 1476 0.03% 38 2071 0.05% 39 3613 0.08% 40 6142 0.14% 41 1617 0.04% 42 1624 0.04% 43 2350 0.05% 44 3929 0.09% 45 7020 0.15% 46 1657 0.04% 47 2274 0.05% 48 3428 0.08% 49 6156 0.14% 50 11595 0.26% 51 2234 0.05% 52 2963 0.07% 53 4559 0.10% 54 8348 0.18% 55 16503 0.36% 56 3054 0.07% 57 4023 0.09% 58 6242 0.14% 59 11722 0.26% 60 25114 0.55% 61 3890 0.09% 62 5105 0.11% 63 7780 0.17% 64 14111 0.31% 65 27245 0.60% 66 4142 0.09% 67 11321 0.25% 68 4289831 94.55% 4537327 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=6.90 fanout-score-rank=12 prefix-density=0.08 prefix-fanout=4.3 sequence=CTGCAGCTGCAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=15 fanout-score=204.39 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=21.6 sequence=TTCTTCTTCTTTT Started job on | Feb 10 23:15:25 Started mapping on | Feb 10 23:15:25 Finished on | Feb 10 23:15:31 Mapping speed, Million of reads per hour | 2722.40 Number of input reads | 4537327 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 4357805 Uniquely mapped reads % | 96.04% Average mapped length | 67.11 Number of splices: Total | 862676 Number of splices: Annotated (sjdb) | 849054 Number of splices: GT/AG | 849930 Number of splices: GC/AG | 10724 Number of splices: AT/AC | 1104 Number of splices: Non-canonical | 918 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.81 Insertion rate per base | 0.01% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 134169 % of reads mapped to multiple loci | 2.96% Number of reads mapped to too many loci | 34243 % of reads mapped to too many loci | 0.75% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.23% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 45353 45353 45353 N_multimapping 134169 134169 134169 N_noFeature 164513 2233053 2261611 N_ambiguous 40476 6264 6590 UnstrandedReadsAssigned:4152816 PositiveStrandReadsAssigned:2118488 NegativeStrandReadsAssigned:2089604 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207789 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207789-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,537,327 reads, 4,263,380 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,030 rounds 52401 SRR3207789.ke.tsv 34699 SRR3207789.se.tsv 87100 total ==> SRR3207789.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 129 23.2687 Potri.005G024800.1.v4.1 1035 936 16 5.91699 Potri.004G059700.1.v4.1 961 862 4 1.60624 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 80.8827 9.84425 Potri.016G087400.1.v4.1 270 171 159 321.853 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 27 5.58297 Potri.012G127500.1.v4.1 977 878 478 188.447 ==> SRR3207789.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 438 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 86 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207789 completed mapping pipeline successfully