Starting /dee2/code/volunteer_pipeline.sh SRR3207790 current disk space = 3057652228096 free memory = 1577486468 SRR3207790 SRAfilesize cb5f5da97ec7c57e46ce85d86bb51c3e SRR3207790.sra SRR3207790.sra file validated SRR3207790 is single end SRR3207790 is conventional basespace SRR3207790 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207790_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.68875 40.0 39.0 40.0 36.0 40.0 2 38.35975 40.0 38.0 40.0 36.0 40.0 3 38.50975 40.0 38.0 40.0 35.0 40.0 4 38.5065 40.0 38.0 40.0 35.0 40.0 5 38.4565 40.0 38.0 40.0 35.0 40.0 6 38.47425 40.0 38.0 40.0 35.0 40.0 7 38.454 40.0 38.0 40.0 35.0 40.0 8 38.35725 40.0 38.0 40.0 35.0 40.0 9 38.36675 40.0 38.0 40.0 35.0 40.0 10 38.31125 40.0 38.0 40.0 35.0 40.0 11 38.3605 40.0 38.0 40.0 35.0 40.0 12 38.346 40.0 38.0 40.0 35.0 40.0 13 38.27575 40.0 38.0 40.0 35.0 40.0 14 38.225 40.0 38.0 40.0 35.0 40.0 15 38.25725 40.0 38.0 40.0 35.0 40.0 16 38.15 39.0 38.0 40.0 35.0 40.0 17 38.10075 39.0 38.0 40.0 35.0 40.0 18 38.0615 39.0 38.0 40.0 34.0 40.0 19 38.0545 39.0 38.0 40.0 35.0 40.0 20 37.99675 39.0 38.0 40.0 34.0 40.0 21 37.96225 39.0 38.0 40.0 35.0 40.0 22 37.86875 39.0 38.0 40.0 34.0 40.0 23 37.81225 39.0 38.0 40.0 33.0 40.0 24 37.736 39.0 38.0 40.0 33.0 40.0 25 37.64725 39.0 38.0 40.0 33.0 40.0 26 37.615 39.0 38.0 40.0 33.0 40.0 27 37.518 39.0 38.0 40.0 33.0 40.0 28 37.34875 39.0 38.0 40.0 33.0 40.0 29 37.27225 39.0 37.0 40.0 33.0 40.0 30 37.2785 39.0 37.0 40.0 33.0 40.0 31 37.1095 39.0 37.0 40.0 33.0 40.0 32 37.02125 39.0 36.0 40.0 33.0 40.0 33 37.01175 39.0 37.0 40.0 32.0 40.0 34 36.9985 39.0 36.0 40.0 32.0 40.0 35 36.924 39.0 36.0 40.0 32.0 40.0 36 36.81875 39.0 36.0 40.0 32.0 40.0 37 36.7725 39.0 36.0 40.0 32.0 40.0 38 36.75425 39.0 36.0 40.0 32.0 40.0 39 36.587 39.0 36.0 40.0 31.0 40.0 40 36.30625 39.0 36.0 40.0 31.0 40.0 41 36.469 39.0 36.0 40.0 31.0 40.0 42 36.2705 39.0 36.0 40.0 31.0 40.0 43 36.22325 39.0 36.0 40.0 31.0 40.0 44 36.126 39.0 36.0 40.0 30.0 40.0 45 35.92575 38.0 35.0 40.0 30.0 40.0 46 36.0575 39.0 36.0 39.0 31.0 40.0 47 35.96025 38.0 35.0 39.0 31.0 40.0 48 35.7525 38.0 35.0 39.0 30.0 40.0 49 35.5745 38.0 35.0 39.0 30.0 40.0 50 35.55825 38.0 35.0 39.0 30.0 40.0 51 35.20175 38.0 35.0 39.0 29.0 40.0 52 35.15275 38.0 35.0 39.0 29.0 40.0 53 35.01725 38.0 35.0 39.0 29.0 40.0 54 34.82575 38.0 35.0 39.0 29.0 40.0 55 34.61825 38.0 34.0 39.0 29.0 40.0 56 34.4045 37.0 34.0 39.0 28.0 40.0 57 34.185 37.0 34.0 39.0 28.0 39.0 58 34.006 37.0 33.0 39.0 27.0 39.0 59 33.8625 36.0 33.0 39.0 27.0 39.0 60 33.5775 36.0 33.0 38.0 27.0 39.0 61 33.3325 36.0 33.0 38.0 26.0 39.0 62 33.123 36.0 33.0 38.0 25.0 39.0 63 32.94125 36.0 33.0 38.0 26.0 39.0 64 32.728 36.0 33.0 38.0 24.0 39.0 65 32.381 36.0 33.0 38.0 23.0 39.0 66 32.0655 36.0 33.0 38.0 21.0 39.0 67 31.82875 35.0 32.0 38.0 20.0 39.0 68 31.4615 35.0 31.0 38.0 17.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 1.0 6 0.0 7 2.0 8 1.0 9 4.0 10 1.0 11 5.0 12 7.0 13 10.0 14 3.0 15 8.0 16 9.0 17 13.0 18 10.0 19 11.0 20 11.0 21 14.0 22 14.0 23 18.0 24 21.0 25 25.0 26 32.0 27 32.0 28 31.0 29 43.0 30 60.0 31 60.0 32 63.0 33 101.0 34 152.0 35 196.0 36 349.0 37 606.0 38 1101.0 39 984.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.675 14.75 15.975 38.6 2 22.89308176100629 21.937106918238992 34.21383647798742 20.955974842767294 3 24.25 25.924999999999997 26.125 23.7 4 25.900000000000002 32.175 21.15 20.775 5 24.925 35.4 22.325 17.349999999999998 6 18.45 39.074999999999996 22.7 19.775000000000002 7 17.025000000000002 18.35 43.65 20.974999999999998 8 20.275000000000002 23.7 30.225 25.8 9 20.25 22.6 31.15 26.0 10 20.075000000000003 38.7 24.375 16.85 11 25.900000000000002 28.975 20.95 24.175 12 20.25 25.2 29.675 24.875 13 20.5 27.925 30.575000000000003 21.0 14 21.7 27.575 29.225 21.5 15 20.95 27.125 29.049999999999997 22.875 16 20.674999999999997 28.225 28.199999999999996 22.900000000000002 17 22.75 28.075 28.325 20.849999999999998 18 21.0 28.65 27.150000000000002 23.200000000000003 19 21.275 29.75 26.674999999999997 22.3 20 22.3 28.525 27.175 22.0 21 20.875 29.2 27.55 22.375 22 21.375 28.525 28.025 22.075 23 22.775000000000002 30.225 26.474999999999998 20.525 24 21.224999999999998 28.775000000000002 28.875 21.125 25 21.65 27.900000000000002 27.675 22.775000000000002 26 21.6 28.175 28.000000000000004 22.225 27 22.375 28.375 27.375 21.875 28 22.2 27.825 28.15 21.825 29 21.099999999999998 29.175 29.575000000000003 20.150000000000002 30 21.925 27.650000000000002 28.025 22.400000000000002 31 21.5 28.7 27.825 21.975 32 21.675 29.299999999999997 27.275 21.75 33 21.675 28.975 27.075 22.275 34 21.175 28.9 27.175 22.75 35 22.15 28.849999999999998 27.125 21.875 36 22.325 28.275 26.724999999999998 22.675 37 22.05 27.975 26.75 23.225 38 21.9 29.475 26.85 21.775 39 21.15 27.05 27.975 23.825 40 22.35 27.35 28.175 22.125 41 22.85 29.349999999999998 26.825 20.974999999999998 42 22.1 28.575 26.825 22.5 43 21.95 27.175 29.2 21.675 44 21.85 28.225 28.1 21.825 45 21.5 27.675 28.299999999999997 22.525000000000002 46 22.725 27.025 28.275 21.975 47 22.650000000000002 27.575 27.625 22.15 48 21.8 28.249999999999996 26.775 23.175 49 21.325 29.599999999999998 28.275 20.8 50 21.349999999999998 29.175 29.075 20.4 51 22.900000000000002 27.025 27.85 22.225 52 22.2 29.549999999999997 26.424999999999997 21.825 53 22.625 29.225 26.8 21.349999999999998 54 22.2 28.999999999999996 26.200000000000003 22.6 55 22.05 28.175 27.725 22.05 56 22.125 26.6 27.750000000000004 23.525 57 21.55 28.425 28.225 21.8 58 22.625 26.375 29.049999999999997 21.95 59 21.95 28.675 27.200000000000003 22.175 60 22.5 28.025 27.35 22.125 61 22.55 28.000000000000004 27.474999999999998 21.975 62 22.275 27.125 28.349999999999998 22.25 63 21.175 28.1 28.675 22.05 64 21.875 28.7 27.900000000000002 21.525 65 21.3 28.999999999999996 27.675 22.025 66 21.575 28.625 27.224999999999998 22.575 67 22.400000000000002 27.325 27.525 22.75 68 22.325 27.200000000000003 27.800000000000004 22.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 3.0 20 3.5 21 3.0 22 2.0 23 3.5 24 7.0 25 9.0 26 10.5 27 18.0 28 24.0 29 22.5 30 32.0 31 43.0 32 53.5 33 83.5 34 103.0 35 120.0 36 157.0 37 177.0 38 201.0 39 250.5 40 297.5 41 319.0 42 340.0 43 368.0 44 375.0 45 370.0 46 349.0 47 333.0 48 295.0 49 244.5 50 232.0 51 212.0 52 168.0 53 144.0 54 121.5 55 81.0 56 63.0 57 53.5 58 39.5 59 35.0 60 33.5 61 21.5 62 11.0 63 8.0 64 6.0 65 6.0 66 5.0 67 5.5 68 4.0 69 2.0 70 1.5 71 1.0 72 1.0 73 1.5 74 1.0 75 0.0 76 0.0 77 0.5 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 41 0.05 0.0 0.0 0.0 0.0 42 0.05 0.0 0.0 0.0 0.0 43 0.075 0.0 0.0 0.0 0.0 44 0.075 0.0 0.0 0.0 0.0 45 0.075 0.0 0.0 0.0 0.0 46 0.075 0.0 0.0 0.0 0.0 47 0.075 0.0 0.0 0.0 0.0 48 0.075 0.0 0.0 0.0 0.0 49 0.075 0.0 0.0 0.0 0.0 50 0.075 0.0 0.0 0.0 0.0 51 0.075 0.0 0.0 0.0 0.0 52 0.075 0.0 0.0 0.0 0.0 53 0.075 0.0 0.0 0.0 0.0 54 0.075 0.0 0.0 0.0 0.0 55 0.075 0.0 0.0 0.0 0.0 56 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399313 spots for SRR3207790.sra Written 399313 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra Read 399299 spots for SRR3207790.sra Written 399299 spots for SRR3207790.sra SRR ids: ['SRR3207790.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i9rps_ja SRR3207790.sra spots: 7985994 blocks: [[1, 399299], [399300, 798598], [798599, 1197897], [1197898, 1597196], [1597197, 1996495], [1996496, 2395794], [2395795, 2795093], [2795094, 3194392], [3194393, 3593691], [3593692, 3992990], [3992991, 4392289], [4392290, 4791588], [4791589, 5190887], [5190888, 5590186], [5590187, 5989485], [5989486, 6388784], [6388785, 6788083], [6788084, 7187382], [7187383, 7586681], [7586682, 7985994]] SRR3207790 file size 1684830 SRR3207790 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207790 SRR3207790_1.fastq Input file: SRR3207790_1.fastq trimmed: SRR3207790-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 23:21:21 2025 >> started Mon Feb 10 23:21:25 2025 >> done (4.000s) 7985994 reads processed; of these: 10060 ( 0.13%) short reads filtered out after trimming by size control 17887 ( 0.22%) empty reads filtered out after trimming by size control 7958047 (99.65%) reads available; of these: 439488 ( 5.52%) trimmed reads available after processing 7518559 (94.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1081 0.01% 19 1821 0.02% 20 3247 0.04% 21 1021 0.01% 22 1348 0.02% 23 2027 0.03% 24 3528 0.04% 25 6545 0.08% 26 1431 0.02% 27 1918 0.02% 28 2860 0.04% 29 4462 0.06% 30 8126 0.10% 31 2043 0.03% 32 2443 0.03% 33 3004 0.04% 34 4957 0.06% 35 8311 0.10% 36 1993 0.03% 37 2575 0.03% 38 3654 0.05% 39 6359 0.08% 40 11008 0.14% 41 2735 0.03% 42 2824 0.04% 43 4056 0.05% 44 6986 0.09% 45 12377 0.16% 46 2903 0.04% 47 3961 0.05% 48 5947 0.07% 49 10874 0.14% 50 20217 0.25% 51 3934 0.05% 52 5284 0.07% 53 8446 0.11% 54 15136 0.19% 55 29499 0.37% 56 5404 0.07% 57 7181 0.09% 58 11201 0.14% 59 20575 0.26% 60 44455 0.56% 61 6951 0.09% 62 9116 0.11% 63 13729 0.17% 64 25438 0.32% 65 47488 0.60% 66 7175 0.09% 67 19834 0.25% 68 7518559 94.48% 7958047 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=9.74 fanout-score-rank=11 prefix-density=0.08 prefix-fanout=5.3 sequence=CTGCAGCTGCAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=13 fanout-score=211.21 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=22.1 sequence=TTCTTCTTCTTT Started job on | Feb 10 23:21:39 Started mapping on | Feb 10 23:21:40 Finished on | Feb 10 23:21:47 Mapping speed, Million of reads per hour | 4092.71 Number of input reads | 7958047 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 7606876 Uniquely mapped reads % | 95.59% Average mapped length | 67.09 Number of splices: Total | 1531014 Number of splices: Annotated (sjdb) | 1508381 Number of splices: GT/AG | 1508690 Number of splices: GC/AG | 18911 Number of splices: AT/AC | 1742 Number of splices: Non-canonical | 1671 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.77 Insertion rate per base | 0.01% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 241744 % of reads mapped to multiple loci | 3.04% Number of reads mapped to too many loci | 88092 % of reads mapped to too many loci | 1.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.24% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 109427 109427 109427 N_multimapping 241744 241744 241744 N_noFeature 284707 3900909 3945981 N_ambiguous 67101 11137 11329 UnstrandedReadsAssigned:7255068 PositiveStrandReadsAssigned:3694830 NegativeStrandReadsAssigned:3649566 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207790 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207790-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,958,047 reads, 7,474,472 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52401 SRR3207790.ke.tsv 34699 SRR3207790.se.tsv 87100 total ==> SRR3207790.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 199 20.5051 Potri.005G024800.1.v4.1 1035 936 16 3.38009 Potri.004G059700.1.v4.1 961 862 6 1.37635 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 121.637 8.4571 Potri.016G087400.1.v4.1 270 171 277 320.308 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 17 2.00806 Potri.012G127500.1.v4.1 977 878 1167 262.821 ==> SRR3207790.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 778 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 118 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR3207790 completed mapping pipeline successfully