Starting /dee2/code/volunteer_pipeline.sh SRR3207791 current disk space = 3057572216832 free memory = 1503927572 SRR3207791 SRAfilesize aab671395765dcace8f7d234df185089 SRR3207791.sra SRR3207791.sra file validated SRR3207791 is single end SRR3207791 is conventional basespace SRR3207791 read1 length is 68 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR3207791_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 68 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 38.704 40.0 39.0 40.0 36.0 40.0 2 38.418 40.0 38.0 40.0 35.0 40.0 3 38.455 40.0 38.0 40.0 35.0 40.0 4 38.481 40.0 39.0 40.0 35.0 40.0 5 38.47475 40.0 38.0 40.0 36.0 40.0 6 38.43475 40.0 38.0 40.0 35.0 40.0 7 38.4005 40.0 38.0 40.0 35.0 40.0 8 38.36675 40.0 38.0 40.0 35.0 40.0 9 38.35325 40.0 38.0 40.0 35.0 40.0 10 38.327 40.0 38.0 40.0 35.0 40.0 11 38.35575 40.0 38.0 40.0 35.0 40.0 12 38.312 40.0 38.0 40.0 35.0 40.0 13 38.3335 40.0 38.0 40.0 35.0 40.0 14 38.27125 40.0 38.0 40.0 35.0 40.0 15 38.267 40.0 38.0 40.0 35.0 40.0 16 38.235 40.0 38.0 40.0 35.0 40.0 17 38.18325 40.0 38.0 40.0 35.0 40.0 18 38.098 40.0 38.0 40.0 35.0 40.0 19 38.11975 40.0 38.0 40.0 35.0 40.0 20 38.07875 39.0 38.0 40.0 35.0 40.0 21 37.968 39.0 38.0 40.0 35.0 40.0 22 37.894 39.0 38.0 40.0 35.0 40.0 23 37.8625 39.0 38.0 40.0 33.0 40.0 24 37.82775 39.0 38.0 40.0 33.0 40.0 25 37.82325 39.0 38.0 40.0 33.0 40.0 26 37.838 39.0 38.0 40.0 34.0 40.0 27 37.66575 39.0 38.0 40.0 33.0 40.0 28 37.6145 39.0 38.0 40.0 33.0 40.0 29 37.506 39.0 38.0 40.0 33.0 40.0 30 37.43425 39.0 38.0 40.0 33.0 40.0 31 37.33475 39.0 38.0 40.0 33.0 40.0 32 37.27675 39.0 37.0 40.0 33.0 40.0 33 37.32575 39.0 38.0 40.0 33.0 40.0 34 37.24775 39.0 37.0 40.0 33.0 40.0 35 37.15075 39.0 37.0 40.0 33.0 40.0 36 37.15975 39.0 37.0 40.0 33.0 40.0 37 36.9165 39.0 36.0 40.0 33.0 40.0 38 36.947 39.0 37.0 40.0 32.0 40.0 39 36.83225 39.0 36.0 40.0 32.0 40.0 40 36.58475 39.0 36.0 40.0 31.0 40.0 41 36.65875 39.0 36.0 40.0 32.0 40.0 42 36.565 39.0 36.0 40.0 31.0 40.0 43 36.57075 39.0 36.0 40.0 31.0 40.0 44 36.476 39.0 36.0 40.0 31.0 40.0 45 36.3275 39.0 36.0 40.0 31.0 40.0 46 36.5505 39.0 36.0 40.0 32.0 40.0 47 36.46075 39.0 36.0 40.0 32.0 40.0 48 36.346 39.0 36.0 40.0 32.0 40.0 49 36.104 39.0 36.0 39.0 31.0 40.0 50 36.019 39.0 36.0 39.0 31.0 40.0 51 35.73175 38.0 35.0 39.0 31.0 40.0 52 35.711 38.0 35.0 39.0 31.0 40.0 53 35.519 38.0 35.0 39.0 30.0 40.0 54 35.322 38.0 35.0 39.0 30.0 40.0 55 35.12725 38.0 35.0 39.0 29.0 40.0 56 35.0415 38.0 35.0 39.0 30.0 40.0 57 34.80175 38.0 34.0 39.0 29.0 40.0 58 34.654 38.0 34.0 39.0 29.0 40.0 59 34.471 37.0 34.0 39.0 29.0 40.0 60 34.28275 37.0 34.0 39.0 28.0 39.0 61 33.99525 37.0 34.0 39.0 27.0 39.0 62 33.785 36.0 33.0 39.0 27.0 39.0 63 33.64325 36.0 33.0 39.0 27.0 39.0 64 33.40575 36.0 33.0 38.0 26.0 39.0 65 33.144 36.0 33.0 38.0 26.0 39.0 66 32.87175 36.0 33.0 38.0 25.0 39.0 67 32.5655 36.0 33.0 38.0 23.0 39.0 68 32.15975 35.0 32.0 38.0 22.0 39.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1 1 0.0 1 2 0.0 1 3 0.0 1 4 0.0 1 5 0.0 1 6 0.0 1 7 0.0 1 8 0.0 1 9 0.0 1 10 0.0 1 11 0.0 1 12 0.0 1 13 0.0 1 14 0.0 1 15 0.0 1 16 0.0 1 17 0.0 1 18 0.0 1 19 0.0 1 20 0.0 1 21 0.0 1 22 0.0 1 23 0.0 1 24 0.0 1 25 0.0 1 26 0.0 1 27 0.0 1 28 0.0 1 29 0.0 1 30 0.0 1 31 0.0 1 32 0.0 1 33 0.0 1 34 0.0 1 35 0.0 1 36 0.0 1 37 0.0 1 38 0.0 1 39 0.0 1 40 0.0 1 41 0.0 1 42 0.0 1 43 0.0 1 44 0.0 1 45 0.0 1 46 0.0 1 47 0.0 1 48 0.0 1 49 0.0 1 50 0.0 1 51 0.0 1 52 0.0 1 53 0.0 1 54 0.0 1 55 0.0 1 56 0.0 1 57 0.0 1 58 0.0 1 59 0.0 1 60 0.0 1 61 0.0 1 62 0.0 1 63 0.0 1 64 0.0 1 65 0.0 1 66 0.0 1 67 0.0 1 68 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 5.0 9 2.0 10 2.0 11 4.0 12 8.0 13 10.0 14 3.0 15 7.0 16 7.0 17 10.0 18 11.0 19 10.0 20 6.0 21 14.0 22 8.0 23 16.0 24 21.0 25 17.0 26 24.0 27 26.0 28 32.0 29 37.0 30 38.0 31 59.0 32 71.0 33 95.0 34 133.0 35 196.0 36 308.0 37 519.0 38 1118.0 39 1178.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.93223305826457 16.804201050262566 13.003250812703177 41.26031507876969 2 21.03284031085485 21.459012283780396 33.59237904236651 23.915768362998246 3 21.575 23.799999999999997 30.2 24.425 4 25.7 28.925 21.85 23.525 5 26.325 32.550000000000004 22.400000000000002 18.725 6 20.9 36.275 23.674999999999997 19.15 7 17.925 19.925 43.225 18.925 8 18.35 25.424999999999997 30.775000000000002 25.45 9 21.675 24.125 30.599999999999998 23.599999999999998 10 20.3 37.95 24.3 17.45 11 25.95 29.549999999999997 20.849999999999998 23.65 12 21.55 25.525 28.1 24.825 13 18.875 30.8 29.799999999999997 20.525 14 20.150000000000002 29.2 27.950000000000003 22.7 15 19.375 28.999999999999996 27.825 23.799999999999997 16 20.45 28.599999999999998 27.375 23.575 17 22.675 28.225 25.95 23.150000000000002 18 23.025000000000002 28.325 27.85 20.8 19 21.7 26.400000000000002 28.799999999999997 23.1 20 21.075 28.475 27.700000000000003 22.75 21 22.6 26.375 29.675 21.349999999999998 22 22.8 28.849999999999998 26.474999999999998 21.875 23 20.5 30.5 27.175 21.825 24 19.975 28.125 27.700000000000003 24.2 25 20.474999999999998 27.075 28.625 23.825 26 20.275000000000002 28.725 28.175 22.825 27 22.0 27.400000000000002 26.55 24.05 28 20.80520130032508 28.40710177544386 26.65666416604151 24.131032758189548 29 22.95 29.65 26.25 21.15 30 22.3 27.425 28.775000000000002 21.5 31 21.3 26.150000000000002 27.975 24.575 32 21.475 29.525000000000002 26.875 22.125 33 20.05 27.825 28.525 23.599999999999998 34 21.65 27.275 26.974999999999998 24.099999999999998 35 22.3 30.975 25.85 20.875 36 23.075000000000003 28.275 26.325 22.325 37 21.5 27.700000000000003 29.5 21.3 38 22.075 28.025 28.4 21.5 39 24.474999999999998 28.299999999999997 25.900000000000002 21.325 40 22.175 29.425 27.325 21.075 41 22.2 29.175 26.700000000000003 21.925 42 20.125 28.749999999999996 29.549999999999997 21.575 43 20.849999999999998 27.825 28.975 22.35 44 21.625 26.825 29.625 21.925 45 21.55 26.700000000000003 28.425 23.325000000000003 46 21.3 27.875 27.825 23.0 47 22.475 28.125 26.35 23.05 48 23.375 26.950000000000003 27.85 21.825 49 21.9 28.249999999999996 27.6 22.25 50 21.875 27.05 29.275000000000002 21.8 51 22.825 27.025 29.275000000000002 20.875 52 22.625 26.650000000000002 27.325 23.400000000000002 53 22.0 27.575 25.15 25.275 54 22.875 28.299999999999997 26.625 22.2 55 23.200000000000003 26.775 27.825 22.2 56 21.85 27.775 28.499999999999996 21.875 57 20.724999999999998 28.599999999999998 28.475 22.2 58 21.75 25.924999999999997 30.525000000000002 21.8 59 21.725 28.425 26.525 23.325000000000003 60 20.0 28.849999999999998 28.975 22.175 61 23.7 27.425 26.825 22.05 62 21.65 28.525 26.674999999999997 23.150000000000002 63 21.475 28.15 27.900000000000002 22.475 64 22.425 26.575 28.749999999999996 22.25 65 22.3 28.1 27.6 22.0 66 22.575 28.799999999999997 27.575 21.05 67 21.95 28.7 26.375 22.975 68 21.775 30.325000000000003 26.8 21.099999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.0 4 1.5 5 1.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 2.5 19 4.0 20 3.0 21 2.5 22 3.0 23 2.5 24 6.5 25 11.0 26 15.0 27 14.5 28 10.0 29 20.0 30 33.5 31 37.0 32 50.0 33 64.0 34 65.0 35 85.5 36 142.5 37 179.0 38 186.5 39 229.0 40 291.5 41 319.0 42 333.5 43 354.5 44 361.0 45 372.5 46 357.5 47 331.0 48 323.5 49 325.5 50 335.0 51 255.0 52 155.5 53 136.0 54 115.0 55 81.5 56 69.0 57 57.5 58 33.5 59 21.0 60 22.5 61 18.5 62 13.0 63 11.0 64 8.5 65 6.5 66 5.0 67 4.0 68 2.0 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.025 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 68 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59037378392217 97.25 2 0.35842293906810035 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051203277009728626 2.0500000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTATGCCGTCTTCTGCTTGAAA 43 1.075 TruSeq Adapter, Index 7 (97% over 36bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATATCTCGTATGCCGTCTTCTGCTTGAA 39 0.975 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 1.15 0.0 0.0 0.0 0.0 2 1.15 0.0 0.0 0.0 0.0 3 1.15 0.0 0.0 0.0 0.0 4 1.15 0.0 0.0 0.0 0.0 5 1.15 0.0 0.0 0.0 0.0 6 1.15 0.0 0.0 0.0 0.0 7 1.15 0.0 0.0 0.0 0.0 8 1.15 0.0 0.0 0.0 0.0 9 1.15 0.0 0.0 0.0 0.0 10 1.15 0.0 0.0 0.0 0.0 11 1.15 0.0 0.0 0.0 0.0 12 1.15 0.0 0.0 0.0 0.0 13 1.15 0.0 0.0 0.0 0.0 14 1.15 0.0 0.0 0.0 0.0 15 1.15 0.0 0.0 0.0 0.0 16 1.15 0.0 0.0 0.0 0.0 17 1.15 0.0 0.0 0.0 0.0 18 1.15 0.0 0.0 0.0 0.0 19 1.15 0.0 0.0 0.0 0.0 20 1.15 0.0 0.0 0.0 0.0 21 1.15 0.0 0.0 0.0 0.0 22 1.15 0.0 0.0 0.0 0.0 23 1.15 0.0 0.0 0.0 0.0 24 1.15 0.0 0.0 0.0 0.0 25 1.15 0.0 0.0 0.0 0.0 26 1.15 0.0 0.0 0.0 0.0 27 1.15 0.0 0.0 0.0 0.0 28 1.15 0.0 0.0 0.0 0.0 29 1.15 0.0 0.0 0.0 0.0 30 1.15 0.0 0.0 0.0 0.0 31 1.15 0.0 0.0 0.0 0.0 32 1.15 0.0 0.0 0.0 0.0 33 1.15 0.0 0.0 0.0 0.0 34 1.15 0.0 0.0 0.0 0.0 35 1.15 0.0 0.0 0.0 0.0 36 1.15 0.0 0.0 0.0 0.0 37 1.15 0.0 0.0 0.0 0.0 38 1.15 0.0 0.0 0.0 0.0 39 1.15 0.0 0.0 0.0 0.0 40 1.15 0.0 0.0 0.0 0.0 41 1.15 0.0 0.0 0.0 0.0 42 1.15 0.0 0.0 0.0 0.0 43 1.15 0.0 0.0 0.0 0.0 44 1.15 0.0 0.0 0.0 0.0 45 1.15 0.0 0.0 0.0 0.0 46 1.15 0.0 0.0 0.0 0.0 47 1.15 0.0 0.0 0.0 0.0 48 1.15 0.0 0.0 0.0 0.0 49 1.15 0.0 0.0 0.0 0.0 50 1.15 0.0 0.0 0.0 0.0 51 1.15 0.0 0.0 0.0 0.0 52 1.15 0.0 0.0 0.0 0.0 53 1.15 0.0 0.0 0.0 0.0 54 1.175 0.0 0.0 0.0 0.0 55 1.175 0.0 0.0 0.0 0.0 56 1.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157353 spots for SRR3207791.sra Written 157353 spots for SRR3207791.sra Read 157366 spots for SRR3207791.sra Written 157366 spots for SRR3207791.sra SRR ids: ['SRR3207791.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sb1tzvme SRR3207791.sra spots: 3147073 blocks: [[1, 157353], [157354, 314706], [314707, 472059], [472060, 629412], [629413, 786765], [786766, 944118], [944119, 1101471], [1101472, 1258824], [1258825, 1416177], [1416178, 1573530], [1573531, 1730883], [1730884, 1888236], [1888237, 2045589], [2045590, 2202942], [2202943, 2360295], [2360296, 2517648], [2517649, 2675001], [2675002, 2832354], [2832355, 2989707], [2989708, 3147073]] SRR3207791 file size 663291 SRR3207791 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR3207791 SRR3207791_1.fastq Input file: SRR3207791_1.fastq trimmed: SRR3207791-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Feb 10 22:58:50 2025 >> started Mon Feb 10 22:58:52 2025 >> done (1.620s) 3147073 reads processed; of these: 4190 ( 0.13%) short reads filtered out after trimming by size control 76284 ( 2.42%) empty reads filtered out after trimming by size control 3066599 (97.44%) reads available; of these: 173303 ( 5.65%) trimmed reads available after processing 2893296 (94.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 456 0.01% 19 736 0.02% 20 1371 0.04% 21 377 0.01% 22 551 0.02% 23 852 0.03% 24 1432 0.05% 25 2645 0.09% 26 605 0.02% 27 768 0.03% 28 1131 0.04% 29 1807 0.06% 30 3260 0.11% 31 839 0.03% 32 1000 0.03% 33 1224 0.04% 34 2012 0.07% 35 3470 0.11% 36 788 0.03% 37 1030 0.03% 38 1487 0.05% 39 2539 0.08% 40 4348 0.14% 41 1143 0.04% 42 1059 0.03% 43 1601 0.05% 44 2754 0.09% 45 4994 0.16% 46 1076 0.04% 47 1486 0.05% 48 2279 0.07% 49 4238 0.14% 50 8051 0.26% 51 1575 0.05% 52 2115 0.07% 53 3362 0.11% 54 5871 0.19% 55 11335 0.37% 56 2120 0.07% 57 2859 0.09% 58 4339 0.14% 59 8070 0.26% 60 17518 0.57% 61 2819 0.09% 62 3579 0.12% 63 5339 0.17% 64 9947 0.32% 65 18567 0.61% 66 2789 0.09% 67 7690 0.25% 68 2893296 94.35% 3066599 reads passed initial QC criterion=sequence-density sequence-density=0.04 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=28 prefix-density=0.07 prefix-fanout=1.5 sequence=GTTATGTTCACTGAGTTTGGATA criterion=fanout-score sequence-density=0.03 sequence-density-rank=16 fanout-score=207.31 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=21.1 sequence=TTCTTCTTCTTT Started job on | Feb 10 22:59:07 Started mapping on | Feb 10 22:59:07 Finished on | Feb 10 22:59:12 Mapping speed, Million of reads per hour | 2207.95 Number of input reads | 3066599 Average input read length | 67 UNIQUE READS: Uniquely mapped reads number | 2921741 Uniquely mapped reads % | 95.28% Average mapped length | 67.09 Number of splices: Total | 584529 Number of splices: Annotated (sjdb) | 575764 Number of splices: GT/AG | 575942 Number of splices: GC/AG | 7344 Number of splices: AT/AC | 693 Number of splices: Non-canonical | 550 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 1.85 Insertion rate per base | 0.01% Insertion average length | 1.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 95409 % of reads mapped to multiple loci | 3.11% Number of reads mapped to too many loci | 29548 % of reads mapped to too many loci | 0.96% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 49449 49449 49449 N_multimapping 95409 95409 95409 N_noFeature 102817 1487936 1518231 N_ambiguous 26620 4141 4108 UnstrandedReadsAssigned:2792304 PositiveStrandReadsAssigned:1429664 NegativeStrandReadsAssigned:1399402 Dataset is classified unstranded MeadianReadLen=68 20thPercentileLength=68 echo kmer=63 SRR3207791 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR3207791-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,066,599 reads, 2,879,059 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR3207791.ke.tsv 34699 SRR3207791.se.tsv 87100 total ==> SRR3207791.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 93 24.8055 Potri.005G024800.1.v4.1 1035 936 4 2.18738 Potri.004G059700.1.v4.1 961 862 4 2.37516 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 51.6871 9.30235 Potri.016G087400.1.v4.1 270 171 114 341.231 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 8 2.4461 Potri.012G127500.1.v4.1 977 878 342 199.375 ==> SRR3207791.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 354 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 63 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR3207791 completed mapping pipeline successfully